GenePrediction:GLEAN_4190 Details

Name: GLEAN_4190
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:346583..344096 (- strand)
Length: 2488
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:346583..345438 (- strand)
Length: 1146
Type: CDS
Source: GLEAN
Position: GCSC_160:345376..344096 (- strand)
Length: 1281
>GLEAN_4190 class=GenePrediction position=GCSC_160:346583..344096 (- strand)
ATGACTGTCGTTGCAACGCCACCCAGCTTCGCCAACATCAACCGGCCGGCATGGGGTAGTGGAAGCAACGGTCCCATCAA
CCACGACGAGGTCAGAGGCATGTTTGCTCCGCGCAAGACAATGCAGCGGACAAACTCGTCGTCCTCCATCGCCTCCAACT
CGTCGACCTCGTCGACCTCGTCCACATCCACCCTCGTCTCGTCGAACGGCTCCATCAACGGCGGTCCTGTTGGTGGCGGC
ACGGCTACGCCCGTGGGCGACTCGAACGGCTTTCCCATCACCACCTTGCGCAAGAGGCCTCCGCAAAAATCATCATGGTC
CACCAATAGGCCTGCAGAAGGGCCATCGGATTTTGTGCGAGGCGGCGGGGGTGGACAGATGCCGACCGCAGGGCTGAACG
GCGCCTCCGCTATGCACCAGATGGCACCCTATGCCTCAGGCCAGATGCCCAATGGAGCCAACGGACTCATGGCCCGCTCT
GCCGGCGAGTCGGCGCCTCCACAGAGCCAGCCGGTCCTGTACCTCATCTCATTGAACGGCACCTTTGACCGCAAGACCAT
CACCGTTCCCTACCATCCAGAGACGCTTCGCATCGGCCGGCAAACCAACAAGACCACCACTCCGACGACTGTCAATGGCT
TCTTTGACAGCAAGGTGCTGTCGCGACAGCACGCCGAGATCTGGGCAGACCGCCAAAGCGGCAAGATCTGGATCCGCGAC
ATCAAATCCTCCAATGGCACATTTGTCAATGGCACCCGCTTGTCTGCCGAGAACAGAGAGTCTGATCCGCACGAGCTACA
GACAAACGACCAGCTGGAGCTGGGCATAGACATTGTAAGCGAGGACCAGAAGTCGGTTGTCCACCACAAGGTGTCTGCGA
GGGTAGAACACGCGGGCTTCATCAGTCCATCGAGCAACCTGCTGGACATGAACTATGGCGACTTGGACCCTGCCAACAAC
TCCATGTTGGGGCCGCAGATTAACGGCATTCCGTACTACGGACGGCCGGGCAACCAATCGTCGCAGGGCACGGCAGGCCG
AATGGCGCCGTCCACAAACATGGCCGTCCAGGCCAACGGGGCCGCTCTGTCACGTAACTTGTGGCTTACCGGTCCCTCAA
CGGAGGCGATTGTGAAGAAGATTCACGTAAGTCTGGCGTCTCGCCGCGGCTTCTCCATCAAGATTGGGACCCTCTAACAG
CGAACAGCAAGAAATGCGTAACGCAAAGCAACAATCCAACGATCTCATACGCACACAGGAGTTCCTGAAAACCCTGCTAT
CGAAAGACGATCTTCGGAACGACCCCAAACGCGACGAGGCTAACGGCTCACGATCATCGCTAATGGTCAATGGCAACGGC
CTGCCCTTCCGGACAGACGCGAAGGCACGCTTCTCCGACCCCCCGGCGCCTCCGCCGCAGCAGCCTCTGCCGGAAAAGCC
AGATGTGCCATCGTTGAAGCGCGGCAGCACAGAGCGGCCGAAGTCTGGGTCTTATCCGAACTCATCCCCTGCCAAGCAAG
ATGCAGTGGGCCAGATGAACCAGCTGTCAGATGCATTGAAGACGGCCAAACTCGAGATCGACACTCAGCACTCTCGTGTG
CGAGAGTTGGAGGATAAACTACAGAAAGAACAGGAGGCGAGAAAGTCGGCCGAGGAGCTGGCACGTCGACTTGAGGAAAT
GACGTCTGCTCGGCATATGAACGGGTCGGCATCGGGCCTGGCTGGTCAAGGCGCAATGCTTGAGGGAGCCTTTGAGCCAC
CGACCGCCGAGTCCGCTGCGGCGGCAGAAAGTAAAGCTGTGACAGGATTAACTGCCGAGAGCGGCCAAACAGCACGTGAG
CTGCAAGCGCTCACCAACGGCGGGCTTGCTGGTGACAGCGTCATCCTCAGGAGTCATGTCGAGTCCATGGTGATGGAGAT
GGAGGGCATGAGGAAGCAGCTGGAAGAATTCCGGAAGCGAGCAGAGAAGGCAGAAGCCGAACGGGACGCCGACCGAGAGA
CGTTGGCGCAGATGGTGATGAGGATCCGCGAGCGAGACGAGCAAGACGCAAAGCTGGCCGCAGCTTCAGGAATAACCGGA
TCCACTGTAGCGACACAGTCGACACAGACGATCTCAAGATCACTGTCACGGGGACGGCAAGCATACAGCATCGGCCTCTT
CAATCTGAGCAGTGTAGCAGATGCCGATAAGAAGGCAGCATCATCAGCAGCTGATGGGTCGAAGCACGGCGCAGAAGTAA
AGGCGTTAGTGGCCAAGTCCCAGACGGAGTCGCAAAAGCAGGGCGAGAAGACTGCAGAGGAGCGTCCGACACTGTCGCGC
ATGAACACCATCACGCCGACGTCCAGCTCGCTCACCAAGACTAGCCGCGAACAGGCAGTCGCTCAAGCCATTCCATATGC
ATCCATGGTCGGCGTCGTCCTGTTGGGCGTGGGCTTGATGGCATACATCAACGGCTGGAAGCCGCAGGCTCCGCGTCTGG
ACTGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62