GenePrediction:GLEAN_4192 Details

Name: GLEAN_4192
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:333579..330886 (- strand)
Length: 2694
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:333579..332162 (- strand)
Length: 1418
Type: CDS
Source: GLEAN
Position: GCSC_160:332107..331700 (- strand)
Length: 408
Type: CDS
Source: GLEAN
Position: GCSC_160:331268..331187 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_160:331125..331018 (- strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_160:330948..330886 (- strand)
Length: 63
>GLEAN_4192 class=GenePrediction position=GCSC_160:333579..330886 (- strand)
ATGTGTCGACCAGCTTCTCGGCTTCCGGTGCCGTCGTCCGGCCTCCTGCACTTTCTCCAGCAGCAGTCCGAACGGCTTTT
TGCAGCCGAGAACATCGGGATATTCCAGCGGGAGAATATACAAGAGCGAAGACGGCACGTGGCAGCACCAGCACCAGCAC
CAGCATACGCTACTGCCGGGCCCAGGCGAGGCAGCCGGTGTTTCCGTGATATGGTGACCACGAGGGCAGCCGTCCCAGCG
ACACAGCCGCGATGGCCGGCTGCACGCATAATTTCACAGCCACTGCCGCTGTCGTCGACGTCCGGCCAGACGGTCTGCTT
CTCGACCTCACGACCGGTCAGGTCATGGAGAAGCTGGAGGTCAGGCGAGAAGCAGCTGCAGCGGCGGCAGAGGGTGTTGC
AGGACCTGAAGGCATGGCAGGAGCGGTTTTGGGGAGGGCATTGGGGCTGGAGCAGCAGCAGCAACGGCGGTGGTGGCGGC
AGCAGCGACAGCCGAGTGGCAGCGATGCTGCTGCCGGGCGATCTGCCGGACCACAGAGCAGGAGCGGAGTTTGCGTCGGT
CATGTTCAACGCGCGACGGTTGCAGACGGCCAAGGCGGCGCTGGAGCCGCGACTACGCTGTACGGAGGTGGACGAGAACG
GCGAGGTGATCCTGGTGGACGGCGAGTTCAAGAAGACGGAGCTGATTGCCAAGTACGGGCTGCTGCCACGCGACTTGCGC
AAGATCGACTCGTCCAACCTGCCGCACATCCTGGTGCGACCGGCGGCCATCTTGTTGAACCTGCTGCACCTCAAGGTGCT
GATCAAGGCCGACCGCGTGCTGCTGTTTGACGTGTACGGGTCCAAGACGTCGTACCCGCAGTCGGCCTTTCTGTACGATC
TGCAGGAGCGGTTGCAGCAGAGGCCAGCCGGGGCAAGCCAGACCACGGCCGAGACGGTGTCGAAGGTGACCTCGCGCCAA
ACCACAGGCCACAAAGGCCACAGAAAGACGCCGACGTCAGTGGCGCCCGGGCTCGGCGGGCTGCCGTACGAGTTCCGGGC
ACTGGAGGCGGTGCTGCTATCGGTAACGTCGGAGCTGGAGGCCGAGTTCGACACGGTGCGCGAGCCGGTGATCCGCATCC
TCAGCGAGTTGGAGGAGGACATCACGCGCGACAAGCTGCGGCTGCTGCTGGTGCTGTCGAAAAAGGTCAACACGTTTGAG
CAAAAGGCCAAGCTGGTGCGCGACGCCATCGAGGAGCTGCTCGAGGCCGACGACGACCTGGCGGCCATGTATCTGACCGA
GAAGAAGCACGACCTCTTCCGCGGCGAGGACGACCACACCGAGGTCGAGATGCTGCTCGAGTCGTACCATAAGATCTGCG
ACGAGGTGGCCCAGGAGGCCGGCAGTCTGGTGTTGAGCATTCGCAACACGGAAGAGATGTGAGTTTTTGTTTCTATCTTC
TCCTTTCTCCCCTTCTCTCTCTGACCCTACAGCATTCGCGCTATCCTGGACGCCAACCGCAACGCCCTTATGCTGCTCGA
GCTCAAGTTCAGCATCGGCACGCTGGGCCTCGCCATGGGCACCTTTTTGGCCGGTCTGTACGGCATGAACCTGGAGAATT
TTATCGAGGAGACCAACTGGGGCTTTGGCAGCGTCACCACCCTGTCCTTTGCCTTTTCCCTGCTGGTTTGCTGGTACGGC
CTGGTGAAGCTGCGCAAGGTCCAGCGCGTCAAGATGCACGGCGGCGGCGGTGGAGGCGGTGGAGGCGGCGGAGGCTTCAA
CTTTGGGTCTGGCGGTGATTTTGGAGGCCTCGGCTACAGCGTCGGAAACGCGCCGCTGGACGCACATAGCCAGGAACGTC
TGCGGCGACTAGGCATGCGCGGTTCCCTGATGCAAAAGAAGTACTACTAGAGGAAGTCCCACCTCCTGCATACGACTATT
GGGAGATTAGGACGGGAATGCGCCTAATGTATTGCCACTCTTGGAAAAGGAGACGAAATACCTGAAGCGTGGCGATGATG
GTGCCCAGTTTTCCGGTTTCAGGGCCGAAGCGGGCTAGCGGCCAGCGAGCTTACATCACTGTCGTCAGTGTGTGCAGATT
CCTACCCCTGTAATTCGTGGGCGGCCGTTAGTGGAGGAACGCCCCCTGTCAACTGCCATAGCTGGCTATATGACATCATG
CCTGACGAGTGACGTGAATGTTTTCATGACAGGACAAGAGGGTGGTATTCTGTTTATTTTTGCGTATATATATGGGGCAG
GATGGAGATGTAAAGAAAACACTCTTGTTATGTATCTGACATCAGACTTCAACTTGTCTACACACCATCAGTAACCTACC
TGTCAATAATCGCTTCCCACTGCACCAATCTGTCCATCCGATCGTCACCAACATGGGTGCCGTTCTGTCCTGTGTATGTC
GCCGTCAACCGGTCTCTCCGTTCATCCTACAGCTTCACTGACTGCCTCTGCTAGATCCAAGGCGTCTTGCGTGCCATTGG
CAATTGTCTCATGGCAATTGTCAACGCCATCGGCTCCATCTTAATGGCCATTGTTAATGGCGTTGTCACAGTTTTCGATG
TGGTAAGAGCAACCATCATTACCGTGCTTTTATGTTGTCGATGCTGACATGCTCCACCTCTAGATCATCAGTTTCCTAAC
GTGCCAGACTTGTCGCGGCGGAGGAATGCGTCGTCGGAGAGGCCACACGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62