GenePrediction:GLEAN_4194 Details

Name: GLEAN_4194
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:326488..324297 (- strand)
Length: 2192
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:326488..326279 (- strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_160:326226..324387 (- strand)
Length: 1840
Type: CDS
Source: GLEAN
Position: GCSC_160:324328..324297 (- strand)
Length: 32
>GLEAN_4194 class=GenePrediction position=GCSC_160:326488..324297 (- strand)
ATGCCGTCCATCCTGAGCGACGCTGACAAAGAGACGGTCAAGCGCTGTGTGCCGAAGCAGAGCAACAAGATCCAGGCGGT
TGCTGTTGCGCGGTTGTACGTGGCGTATCCGAACCGATCGCGATGGAAGTACACGGGTCTGCAGGGGGCAGTGGTGCTGT
GCAACGACCTTGTGGGCAACACGTTCTGGATCAAGATGGTAGACATATCGGTAAGTGACCGGATCCGACGGCAACCAAAC
AAACTAACGACTAACCAAATAGGCGGGCAGCCACGGGGTGATATGGGACCAGGAGATCTACGACTCGTGGCGGTACAACC
AGGACCGCATGTTTTTCCACACGTTTGAGCTGGAGGACTGTCTGGCGGGCCTGTCCTTCTCGGACGAGAAGGAGGCCAAG
CAGTTCAAGAAGAAGATGGACGACCGCGAGAAGAATGCGAGCAAGGCGACGCGGGCAACGCCGTTTGGCGGCACGGTGCA
GAGTCATGGGGGTGGTGCAGCGGGCGGCGGAGCGGTCAAGCACTCGCTGCTGGGCGGGCTGTTCCACCGACACGCGACGA
CGCCGCCGGACTCGCCGCACGCGAGCGGAGCAGCAGCGAACCCTTACAGCACGAACGGAAACGGAAATGGAGCATCGGCA
CAGCAGACGACGCCATCCGAGTTTGCCACACTGGAGGCGTTTGACCAGAACTGGCGGGTCAACTTTGGCGACGACCTGCG
GCACAAGGGGCTGACGGACGAGTTTATCCGCGAGAACCAGGATTTTATTGTCGATTTTCTGCGGCAGCAGCAGACAGCCA
ACGACGGATCAGCAGGCTCTGGAGGCTCTGCAGCGCCCAAGCAGGCTGCACCGCCGCCACCGCCGCCAGCGGCAGCGGCA
AGTGGACCGGGCACACGGGCGCCGCCACCGCCTCCGCCTCCGGCAGCAGCAGCCGGAGGATCGCGCAGCAATGCAGACTC
GGGAGGCTCGGCGAAGCGGCCAGGCGGACTGCCACCACCGCCACCGGCACCTCGGCGTATGGGCAAGGGCGAGACGGCGT
CGACAGCGCAGACATTGGAGGCGGATCGAGATCGTGAGCCATCGCCACCGCCGCCACCACGGCCACGGTTTGCGGTACCG
CCACCGCTTGCGGATGCCGGTAAGTACGCGCATTCGCAGCCGTCGCCCCGATCGCCGCGTCACGTGACCTCGGGACCAGG
ACCAGCACCGCCGCCACGACCACCCAAGACAGCGATGGATGGCGAGGACGCGGGCAACAACGGCAACGGTCCGCATCGCT
TTGGTGTGCCACCGCCATTCCCAGGCCAGCGTCCAGTGCCGCCGCCGCCAGCCAGTCGAGGAGCAGCACCTGTGGTATCG
TCACGTGACTCGGGGCCATCATCTCCACCACCACCGACGCCTCCTCGCGGGTCTGGTGGGCTCTCGCACAGCAACTCGCA
CGGCTCGTCATCGCGGCCAGTGCCGGTACCACCACCAGCACCGCCGACACGCAACAGCGGCCACTACCAGCCAGCAGCAG
CAGCACCACCACCGCCACCACCGCCGCCACCGGCTCCGGCTCCTCCGGCACAGCCGATGTCGACGACGTCCTACGGTGCT
CCGGCCCCCGTGGCGCCTCCTCCTCCACCGCCACCACCACCACCGCCAATGCCAAGTGCCGGAGTACCACCACCACCACC
ACCACCTCCTCCTATGCCCATGAGCAGCGCGGGAGGACCAGCGGCACCGCCACCAGCACCTCCTCCTCCTCCTCCTATGC
CCATGGGCAGCAGCGCAGGAGGGCCATCGGCACCGCCACCACCACCGCCTCCACCACCACCTCCGGTTGGGGGCGGCGCA
TCGTCGCTGCCAGCGCCTAGCCAGGGCAAATCGGCGGTGCTGGCGAGCATCCAAATGGCAGGCGGGATTGGAGCGTTGCG
TAAAGTGGACCGAAGCCAAATTCGGGACCGCAGTGCAGCAACAATGGGTGGCAGCACGGACACGGGGCCACACGGCAGCG
GACTGCCGCCAAGCGGGGCAGCAGCAGGTGGCGGAGGCGGTGGCATGGCCGACGCACTCGCTCTTGCGCTGCAGAAGCGG
AAGGAGAAAGTCAGCGCCAGTGGTAAGTTGTTTTGCTATGTACTTGTTCTTGTACATTATGTTTCGTGCTAACCAATCAG
ACGACGAGGCAGACGATGACGACTGGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62