GenePrediction:GLEAN_4196 Details

Name: GLEAN_4196
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:322574..321113 (- strand)
Length: 1462
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:322574..322503 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_160:322417..321113 (- strand)
Length: 1305
>GLEAN_4196 class=GenePrediction position=GCSC_160:322574..321113 (- strand)
ATGCTCGTCTCGCTCACGGTCGGCAAGGTCGACGCCGGCGTGACCGTGCTCCTGACCCAGGATAAGCGTTTGGTGAGTGT
CTTTTGTTGTCTCTCATGTGGCTTCGGTCTCTCCTTCTCCTCGCCCTTCTTCTCTACCCCCCCCACTAACTTTTCAGATC
GAATTCCCGTCCATCCTGCTGCCGCCCAACATCTCGTCCGGCTCCATTGTCGACATCGCTGTCAGCCGCAACCGCGCGTC
CGAGACGACCGCCGAGGCCGCCTTTGCGAGCCTGCAGAAGCGCATACTCGACACGTTTGGCACCGAAGCCCCGGCTGCGC
CCGTGCTGCGCTGCCGCAATGCCACCCAGACGAGCGTCGTGCTGGAGTGGGACCCCATCCGCATGGCCACGGCCGACCTG
CTGGGCCTGGCGCTGTACCGCAACGGCCAAAAGGCTGGCAACATCCCGCGACCGCTGCAGATGCACTCGACCAAGATCTC
CGGCCTCGCCGTCGACACCGCCTACACCTTCCACCTGGTCTTGCGCACCAGCGCTGGCACCCTGACCAGCGACCGTGTCG
CCGTCCGCACCCACAAGATGACCGATCTCAGCGGCATCACCATCAGCACCGGCATCCTGCCCGTGCCCGCCCGCCAGCGT
CTCGCCGCCGCTGTCGACCGCATCGGTGCCCGTCTCGTCACCGAATCCGGCCTCGTCCGCATTGACACTACCCACTTTGT
CACCACCGAAGGCCGCGGCCTCGGCTGGGAAAAGGCCACCGAGGTCAACATCCCCGTCGTTCGCCCCGAGTGGGTTGAGG
CCTGCGAGGCCAGCGGCCGCATCCTCGGCGTCACAAAGTTCTACCTCGACGCCGTCCGCCTGCCCAACGACTCGACTGAC
GAGAGTGCCGCTGCCGCTGCCGTCGCCGCCACTGCTGCTTCAGCTACCGCTGCTGCTGCCGCTGCTGCTGCCGCTGCCAC
ATCCTCTCCCAAGTCACCGCCTGCACCACCGCGACAGCAACAACAGCCGCAGCAGAAGCAGCTGTCCACAAAGACTGTCG
CTCCAGCTCCGGCCCCGCCCCCGCCTCCGGCCCCGATGACCCCGCCCAGAAGAGACGACACCGAGAGCAGCAGCAAACGT
GGCAGTAGCAGTGCCAGCAGCAGCAGCAGTGTCGCAAAGACCCCGGCAGACGGAAAGCCGCCGGACAAGGCCACCGTGGA
GCAGAATATGGCCCTGCGGCCAGCAGACAGCGCAAAGAGCAACAGCCAGGAGGCCCAGGACAAGGACGACGACGACGACG
ACGACGATGAAGAGGATGAAGACGCGGACGTGGACAAGGCCGAAAAGGAGGACACCACTCGTGGGAACGGCAAGAAGCCG
CTGCATCTTCAATTGCAGACCGCACACAGCGTCGACAAGCTCGGCGAGCTGAAGCCATCGACACCAGGCGACGGCGGCTC
GTTCCAAGATGTGGCCCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62