GenePrediction:GLEAN_4197 Details

Name: GLEAN_4197
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:306045..305298 (- strand)
Length: 748
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:306045..306033 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_160:305814..305635 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_160:305569..305298 (- strand)
Length: 272
>GLEAN_4197 class=GenePrediction position=GCSC_160:306045..305298 (- strand)
ATGGTCAAAGCAGGTATGCATATCCCACTCCCTCTTGCAGCCCTGTTGGATCGCTTTTATGGGTACCTTTGCGGCATGGT
GTCCGACTCTAGAGCTCGAGTGATCAAGTTTTCCGTTTCGGGCGTGTCGATATGGCTCGTCTGCACACCTTGATGGTTCC
TGGCGCAGGGCAGACTCTTCTATTGGCTGGTGAGAGGTACCGACGAAGATCAGCCTCGCTAACAGGCTCAGTTGCTGTCG
TCCGTGGTGACGCCAAGGTGTCCGGCACCGTCATCTTCGAGCAGGTGTCCGAGTCTTCGCCTACCCGCATCACCTACGAG
ATCACGGGCAACGACGCCAACGCTGAGCGTGGCTTCCACATCCACACCTTTGGCGACAACACCAACGGCTGCACCTCGGC
TGGCCCTCACTGTAAGCTATCCTGTTCTGCTGCTTCTGTCGTTTCTATTCTCGCGGCCCTATTAACCGCGGCGCAGTCAA
CCCCTTCGCCAAGACCCACGGTGCGCCGACCGACGAGGTCCGCCACGTCGGCGACCTCGGCAACATCACCACGGACGCCC
AGGGCATTGCCAAGGGCACCATCGAGGACAAGCTCGTTCAGCTGATCGGCCCCAACAGCGTCATCGGCCGCACCGTTGTC
GTCCACGGCGGCACCGACGATCTCGGCAAGGGTGGCAACGAGGACAGCCTCAAGACCGGCAATGCCGGTGCCCGTCCGGC
CTGCGGTGTCATTGGCATCTCGGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62