GenePrediction:GLEAN_4198 Details

Name: GLEAN_4198
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:304207..301401 (- strand)
Length: 2807
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:304207..303186 (- strand)
Length: 1022
Type: CDS
Source: GLEAN
Position: GCSC_160:303122..302777 (- strand)
Length: 346
Type: CDS
Source: GLEAN
Position: GCSC_160:302699..301401 (- strand)
Length: 1299
>GLEAN_4198 class=GenePrediction position=GCSC_160:304207..301401 (- strand)
ATGTCCAAGGTCTTTGTCGCCGTTGTCAAGTCTGTGCTGAGCGGTGACACCCTCGTCCTCACCAGCCCCAACAATCCGAC
TCTCGAGCGCACGTTTTCTCTGGCCTTTGTCAGTGCGCCCCGCCTGAGCAAAGACAACGAGGAGCCGTTTGCGTTTCAGT
CTCGCGAGTACCTCCGCACGAACGTCCTCAACAAACAGGTCCAATGCACCGTTCTGTATACCGTGCCGTCGTCGCAGCGT
GATTACGGCACAGTGCTCGTCAAGGACAGCCCCGAGCTGCCGGATGCGCCCGTCTCTGCCGGTTGGCTCAAGGTCCGCGA
GGATGCTGGCAAGAAGGAGGAGAGTGAGGAGATCGTGCAGCGCCTCGAGACCCTGCGCAGCCTCGAGTCCCAGGCACGTA
CCGACGGTCGTGGCCTCTGGTCCGGCGCCGATGGCTCCATCCAGGTCCAGCACGACCTGGGCGGCCCCGGCTTCCTCACG
GAGTGGAAGAGCAAGACGGTCGACGGCATCATCGAGCGCGTGTTTGCGGGCGACCGCCTGCTTGTACGCCTGCTGCTGTC
CGACAAGAAGCACGCCCAAGTGATGACGCTGGTTGCCGGGATCCGCACTCCGGCCACCGAGCGCGTCAACCAGTCGACGG
GCGAGACCCAGCCCGGCGAGGAGTTCGGCAAAGAGGCACAGCGCTTTGTCGAGACACGACTACTGCAGCGCCTGGTCAAG
ATCCAGATCGCCGGCGCAAGTCCACAGGGCCAGCTGGTCGCGACCGTCCTGCACCCGCGCGGCAATATCGCCGTCTTCCT
CTTGGAGGAAGGCCTGGCGCGCTGCAACGACTTCCACTCCACCATGCTTGGCGACCGCATGCCGTCGTTGCGGGCTGCGG
AGAAGGTGGCACAGGATGCGAAGAAGCGCCTGCATAAGAACCACGTTGCCAAGGTGTCGGAGGGCAACCTTGATGCCACC
GTCATCAAGATCATCAGTGCCGACACTATCATTGTGCGGAATAAGTCGGGGGCCGAGAAGCGGTAGGCATTGTTCCCAAG
CGTGTTGGAGGTATCTAAAATCGACAGATGTCTAACATGCAGCAGACTCCAGCTTAGCAGCGTCCGTGGACCTCGTCGCA
ACGAGGCCACCGAGGCTCCGTTCCAGGACGAAGCAAAGGAGTTCCTTCGCAAGAGGCTCATTGGGAAACACGTCCGCGTC
AGCGTTGACGGAACTCGCCCGGCTACAGAGGACTTCGAGGCCCGAGATGTGGCCACGATTACGCACAACGACAAGAACTT
CAACCTGGCATTGGTGCAGGAGGGCTATGCCACGGTCATCCGTCACCGGAAGGACGACACGGACCGCGCGCCCAACTACG
ACGAGCTGCTAGCGGCACAAGAAACAGCCAAGGAAGCAAAGAAGGGCATGTGGTCAGGGAAGTCGCCAAAGGTAGGTTCA
AAGGATGTGCGGATCGGGGGGTTTTATTTTCCCATTTCTACGTCTCGTCATACTGACACGCGAATCAGATCAAGCAATAC
GTTGATGCATCAGAGACAGTGCAGCGGGCAAAGATCCAGGCGTCGACTTTGCAACGGCAAAAGAAGGTTCCCGGCATCGT
GGACTTTTGCAAATCTGGATCTCGCTTCACGATCCTGATCCCGCGCGAGGGAGTCAAGCTCACACTTGTGCTGGCAGGCA
TTCGGGCGCCCCGTGCGCCTGGGCGGAATACACAGGACAAGGGTGAGCCGTTTGGCGAGGAGGCTCTGGAGCTGGCCAAC
CGGCGGTGTAACCAGCGCGACTGCGAAATCGACGTGCACGACGTGGACAAGACAGGCGGCTTTATCGGCGAGTTGTTTGT
GAACCGCGAGAGCTTCGCCAAGGCGCTCGTGGAGGAGGGTCTGGCGACGGTGCACCAGTACTCGGCGGAGAAGTCGGGCA
ACGCGGCAGAGCTCAACGCAGCAGAGCAGCGGGCAAAGGAGGCACGGAAGGGCCTATGGCACGACTGGGACCCGTCGCAG
GATGAGGTGGCAGAAGAGACCAACGAAGCGAGCGGCGGGACGGCAGCGACTGCAGAAGGCGTGACGCTGGAGAAGCGGCC
ACAGGACTATCGGGACATTGTGGTAACCAACATCGACGCAAACGGGCGGTTGAAGATCCAGGTGATTGGCCAGGGGACGG
CGGCGTTGGAGACGCTGATGAGCGACTTCAAGCGGTTCCACCTAGACAGCAAGAACAAGGTAGCGATCCGGGAGAACCCC
AAGGCGGGCGATTATGTATCGGCGCAGTTCTCGCTGGACAACCAGTGGTACCGGGCCAAGATTCGGTCCAACGACCGGAC
GGCCAAGGTGGCCGAAGTGGTGTACGTGGACTACGGCAACAGCGAGAAGATTCCGTGGTCGAAGCTGCGGCCGCTGGACG
CAAGCAAGTTCGGGACGCAGCGGCTCAAGCCACAGGCTGTGGACGCGGTGCTGTCGTTTGTGCAGCTGCCGACAGCCGTG
GACTACTTCCAGGACGCGATGAACTTCATTGCCGAGTGCACAGAAGGACGACAGCTGGTGGGCAGCTTTGACTTTGTGGA
TGCCAAGGAGGGCCTCAGCTACATCACGGTCTTCGACCCGAAGACGGGCGGCGACGGGCCGGAGCGCAACGAGTCGCTCA
ACCGCGAGGTTCTTCGAAACGGACACGGACTGGTGCCCAAGAAGCTCAAGGTGTGGGAGCGCAGCGCAGTGTTTGAGCCG
ACGCTCAAGGTGCTGCGGGCGGCGGAGAAGGAGGCCAAGGAGGGCAAGTACGGCATGTGGGAGTACGGCGACATTACAGA
GGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62