GenePrediction:GLEAN_4199 Details

Name: GLEAN_4199
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:298220..296939 (- strand)
Length: 1282
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:298220..298182 (- strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_160:298058..298040 (- strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_160:297972..297961 (- strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_160:297895..297612 (- strand)
Length: 284
Type: CDS
Source: GLEAN
Position: GCSC_160:297559..296939 (- strand)
Length: 621
>GLEAN_4199 class=GenePrediction position=GCSC_160:298220..296939 (- strand)
ATGGCTTCTTCTCTGGAACAGCTGAAGGCCTCTGGCACGGTATGTCATGGCGCACTCGGCGTGCATTAGCATAATCACCG
CTTCTCCCACAGCTATCTAGCAGTTTTCCCTCTCTGTCCTTCTACCTGTCTTTTGCTGACTGGCTACTTTTGCTTCTCAC
AGGTCGTTGTCAGTGACTCTGGTAAGTCTTCTGTGCCTTCCGGCCGCTCCGGCCTTTTGCATAGCTGAATACTAACACGT
TTGGCCAGGTGACTTTGCTTGTTAGTTTGGCCTTGCCCTTCCGAAATTATCCTTCTTGTTCCTTTCCTTCTGCTCACAAC
CACAGCCATCGCCAAGTACAAGCCCCAGGATGCCACCACCAACCCATCCTTGATCCTGGCCGCGGCCAAGAAGGCCGAGT
ACGCCCCGTTGATCGATGCCGCCGTCGCCTACGGCAAGAAGCACAGCGGCTCTGTCGACGAGCAGGTCGATGCTGCCCTG
GACGCCCTTCTGGTCGAGTTCGGCCGCGAGATCCTCAAGATCGTCCCCGGCCGCGTGTCCACCGAGGTCGACGCCCGCTT
TTCTTTCGACACCAAGGCGTCAGTCGACAAGGCCCTGCACATCATTGACGTACGTTTTGACTTTAGCATCTTTCTGTCCT
ACGGCCGCTAACCCTCCCCAGCTGTACAAGGAGCAGGGCATCTCCAAGGACCGCATCCTGATCAAGATCGCCTCCACTTG
GGAGGGCATCAAGGCATCCGAGATCCTGCAGCGCGACCACGGCATCAACACAAACCTCACCCTGCTCTTTTCGCAGACAC
AGGCTATTGCCGCCGCCGAGGCCGGTGCCTTTTTGATCTCCCCCTTTGTCGGCCGCATCCTGGACTGGTTCAAGGCCAGC
ACCAAGAAGGCTTACACCAAGGACGACGACCCGGGCGTTTCTTCCGTCAAGGCCATCTACAACTACTACAAGAAGCACGG
CTACAAGACCATCGTCATGGGCGCGTCGTTCCGCAACACCGGCGAGATCACCGAGCTGGCCGGCTGCGACTACCTGACCA
TCTCGCCCTCTCTGCTGGAGGAGCTGCTCAACTCGACCGAGGCCGTGCCCAAGAAGCTGGACGCTGCTGTCGCTGCCACT
CTCGACATCCCCAAGAAGTCCTACATCAACGACGAGGCCTTGTTCCGCTTCGACTTCAACGAGGACCAGATGGCCGTCGA
GAAGCTGCGCGAGGGCATCAGCAAGTTTGCTGCCGACGCTATCACCCTCAAGGACATCCTCAAGGCCAAGATTGCCGCAT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62