GenePrediction:GLEAN_419 Details

Name: GLEAN_419
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1662997..1663504 (+ strand)
Length: 508
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1662997..1663026 (+ strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_167:1663107..1663273 (+ strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_167:1663330..1663504 (+ strand)
Length: 175
>GLEAN_419 class=GenePrediction position=GCSC_167:1662997..1663504 (+ strand)
ATGTCGCTGTCAAACGAGGCGCTGCAGAAGGTAAGCAAGCGGTCGTGCGAGCAGGGCGCACGTGTTCATGTCCATGTCCA
TGCCGTCTGGCTAACGGACCGGGTCGACAGCTGGTGAGGGAGATCGAGACGCAGGCGATTCAGGCGCAGCAGCAGATCAC
AGTGGCGCGGTCACAGGTAGCCAGCAAGCAGCGAGAGATGCGGCTGGCCCAGCTGACACGAAGCGAGCTGGCGGCACTGC
CGACCGACACGGCAGTATACGAGGGCGTGGGCAAGATGTGGGTTTCTCTTTCTGTCCAATGTTTGCGTCTGCCTCTCTTG
CTAACGCGTGCAGGTTCGTGGCCGAGCCGGTGACGGAGCTGAGCGCGAAGCTGGACAAGCAGATCAAGGGCCTCGAGGGC
GACGTCGAGGGCCTGGGCAAGCGGCTACACTACCTCGAGACGACGGCCAAGAACAGCCAGGAACACATCAGCCAGATGCT
CCGTCGCGGCGGCGGTGAGGCGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62