GenePrediction:GLEAN_4200 Details

Name: GLEAN_4200
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:292425..290390 (- strand)
Length: 2036
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:292425..292323 (- strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_160:292254..292159 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_160:292023..290390 (- strand)
Length: 1634
>GLEAN_4200 class=GenePrediction position=GCSC_160:292425..290390 (- strand)
ATGCTAACTGCCGGGACTGCCAGCCCCGAATACACGGCCCTCGTCAGCTCAATCTTTCTAGTTGCCCTCGAGGCTACCAT
CCGCATCCTCACCCTGTGTCTGCGTACGTCGGTCTGGCATCGCGTCGTCTGTTCCGTGCCCCCTGACTTGTTGATCCTAA
CGTGTCTGCAGCGAGTTGGCTCATCGATCTCTGCTATCGTGCCTCGCGAAGGATATTTAATCGGTTCACCAGCCCGGCCC
AGAAGCGAGCCCAGGAGAAGAAGAAATGTAAGCGTTTCCTGTTTCCTGTTCTTTGTTCTTTGTTCTTTGTTCTTTGTTGT
CTTTGTCTTTTAGTCCTTGTTTTCTTCTTTCTCGTCGCCTGTCTCAGATCGGTGTCTCGCCACCCGCACTAACGGGATCT
AGCCATCTCGACCTCGATCAGCGATGCGTCCGACTTTGTCGAGCTCTGTCGCGTCTTCGGCTACACGGCCGAGGAATACG
TCTTCTCGACCAAGGACGGCTACCTGCTCGGCCTTCACCGCCTGGCCTGGCGGCGGGGCGAGGAGGACGTCAAGGTCAAT
GATGGTCCACGCAGCGTGGCCAAGCGCGTGATCTACATGCACCACGGCCTGTTGATGAACAGCGAGGTGTGGGTGTGCGC
GACCGATGCGCGGCGCTGTCTCCCCTTCATGCTGGTCGAACGCGGCTTCGACGTCTGGCTGGGAAACAATCGCGGCAACA
AGTACTCGAAGAAATCGGTTAACTGCTCAGCCGACAGCTCCGTCTTCTGGAACTTCTCCATCGACGAGTTCGCCTTCCAC
GACATCCCCGACAGCATCGCTTACGTGCTCGACGTCACCGGCCAGCCGTCCCTTTCCTACATTGGCTTCTCACAAGGCAC
TGCTCAGGCCTTTGCCGCCTTGGCCATCCATCCCAAGCTCAACGACCAGGTCAATGTGTTCATCGCACTCGCACCCGCCA
TGTCGCCGGCCGGCCTGTCCAACGGCATCGTCGACGCACTCGTCAAGGCATCGCCGCAGGTGCTGTATCTGCTCTTTGGC
CGTCATTCCATCCTCAGCTCGGCCACGCTCTGGCAGTCGCTCCTCTATCCGCCGTTGTTTGTGCGTGTCATCGACCTCGG
CCTGAGCTTCCTGTTTGGCTGGCGCACCGCCAACATCTCCGCGTCCCAGAAGCTGGCCGCATACCCCCATCTCTACTCCT
ACACCAGCACCAAGTCGGTCGTGCACTGGTTCCAGATCATCCGCACAAAGTCGTTCCAGATGTACGACGACGACGTGCAT
CCGCCGCTGGCCCTGCACTCCAAGCACACCAAGGTGGCCAAGTATCCGACGCGCAATATCAAGACGCCTGTGGTCCTGGT
GTACGGTGGCATCGATTCGCTGGTCGACATCCGCGCGATGCTGCGCGAGCTGCCGGCCCAAACTGTTGCCACCGAAATCC
CGCACTACGAGCACCTTGACTTTCTGTGGGCCCGCGACGTCGACAGCCAGGTCTTCCGCCACGTCTTTGACGCTATCGAC
AGCTTCACCGGCGCCGAGCATACCAAGGAGGAGTATGCACGCTACCGAAACGCCCGTCACGCGAGCATGAATTCGCAAGT
CGTCCACTATCTGCCTGAGAGCAGCGACGCCGTTGACAGCGACCAGAGCGCCCAGAGCGATCAGGACGGCCAGATTGCCG
TCACCACGACCGTGTCTGACAAGGCGGTTGAACAAGACAGCCACGGTCATGAGCACACCACCACACCACCGCTGTCGGGC
ACGGCCGAGACGGTCTCGACGATGGAGACGGACGAGACGGCAGCATCGGCAGCGGTCGTCATGACACCCACGCTGCGCAA
GACCTCGTCGCAAAAGTTCCGCAATGCCGGCAGCCTGCGAATTGGCTCGCTCAGAGGCAGCAAAGGCATCAGTGACGGCA
TCCGGCTCGGTAGCAGCAGAGCCGTGGGAGGTGTGACGACAGAGGCAGCGGTAGGCAGCGCAATCGGCGGGACTTCCAGC
TCAGACGAGGGCCGAAAGCGGGCAGCCTCCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62