GenePrediction:GLEAN_4201 Details

Name: GLEAN_4201
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:286658..284890 (- strand)
Length: 1769
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:286658..285090 (- strand)
Length: 1569
Type: CDS
Source: GLEAN
Position: GCSC_160:285012..284890 (- strand)
Length: 123
>GLEAN_4201 class=GenePrediction position=GCSC_160:286658..284890 (- strand)
ATGTCTCTCTCGGCGGCGACAATGCGGTCGCTTGGCTGTCGACGTCCTGTCCGTCTGGCGCGCACGGTGGCCAGTTTTGC
GGCTGGTGGTTTTACGGCCGAGGCGCTCTCGCGGCTGCCCACGACCGTCGACGTCTCGTCCGACGGCTTCCGCGAGAACG
CGCGGCTGATGCGGGCGGCCGTCGATCGGGTCGAGCAGCTGACGCGACAGGCCCAGCGCGGTGGCCCCGATACGGCACGA
GCAAAACATGTGGCCCGCAACAAGATGCTTCCGCGCGACCGCGTGGCCGCGCTGCTGGACGTGGGCTCGTCCTTTCTCGA
GCTCTCACCACTCGCCGGCCATGGACTTTACGGCGTCGCCGGCACTGCCGCCGATGTTGCGGCTGGTGGGATCATCACAG
GCATCGGCCGCGTCGCCGGAGTCACGTGCCTTGTGGTCGCCAACGACAGCACCGTCAAGGCCGGCTCCTACTATCCCATC
ACGGTCAAGAAGCACCTGCGCGCACAGGAGGTGGCGGCACAGAGCCGGCTGCCGTGCATCTATCTCGTCGATTCGGGCGG
CGCCAACCTGCCGCTCCAGGCCGACGTCTTCCCGGATCGCGACCATTTTGGCCGCATCTTCTTCAACCAGGCCCGTCTCT
CGGCCGCCGGCATCCCCCAATTGGCCGTCGTCATGGGTCCCTGCACTGCTGGCGGTGCCTATGTTCCTGCCATGAGCGAT
GAGAGCATCATTGTCGACCGACAGGGCCACATCTTCCTCGCCGGGCCGCCGCTGGTCAAGGCTGCCACCGGCGAAGATGT
CAGCCCCGAAGATCTCGGTGGCGGCCGCATGCATTCGACCGTTTCCGGTGTCACAGACCATCTCGCCGTCGACGATGCCC
ATGCTCTCGCTCTCGCCCGCCGCTGCATCGCCGACCTCAACTACCCGCCTGCCGACAGCCCGTCCAAAGACGCTACTCCC
CCTCTCTACGACCCCGACGAGCTGCTCGGCATCGCCTCCACAAATCTTCGCCAGCCTATCGACCCCCTCGAGATCATCGC
CCGCATCGTCGATCACTCTGCCCTGGCCCAGTTCAAGCCAGACTACGGTACCACTCTCGTCACTGGCTTCGCCCGCATCC
ATGGCCATCGCGTCGGCATTCTCGCCAACAATGGCGTACTCCTCTCGGCTGCCGCTCTGAAAGGCGCTCACTTCATCGAG
CTCTGCGCCCAACGTGGCATTCCCCTTGTCTTTCTCCAGAACATCGCCGGCTTCATGGTCGGCTCTGCTGCCGAGCGAGA
CGGCATCGCCAAGCACGGCGCAAAGCTCGTCGCCGCCGTCTCCTGTGCCGCCGTCCCCAAGTTCACCGTCGTCGTTGGCG
GAAGCTATGGCGCCGGAAACTACGGCATGTGTGGCCGTGCCTACAGCCCCCATTTCCTCTGGATGTGGCCCAATGCTCGC
ATCGCCGTCATGGGCAGCGAGCAGCTGGCCACCGTCATGGAAACTGTCGGCACCCGCAATCCCGATCCACAACTGCGTAC
TCGCATCGATGCTGAGAGCGATGCCGTCTTTTCTACCGCCCGTCTTTGGGTGCGTTCGTTTCTGTCCCCTTTTTCTGCTC
CAGTCTTTTTCCCCCTAATACACATTGCTGACTAATACTGCTCCAGGACGACGGCATCATTCCCCCTCAACACACCCGTC
GCTACCTTGGCCTCGCCCTGAGTGCTGCCATGGGTGGACGCAATTGCGTCGCCCCCAATGAGACCAAGTTCGGTGTATTC
CGCATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62