GenePrediction:GLEAN_4202 Details

Name: GLEAN_4202
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:277937..276593 (- strand)
Length: 1345
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:277937..277784 (- strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_160:277725..277659 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_160:277403..277053 (- strand)
Length: 351
Type: CDS
Source: GLEAN
Position: GCSC_160:276890..276593 (- strand)
Length: 298
>GLEAN_4202 class=GenePrediction position=GCSC_160:277937..276593 (- strand)
ATGTCCACATCGGCCCTCTCAACCATCGGCCCGCCCAACTTTTCTCTCAGAGGCAAGCTCGTGCTCCTCACTGGCGGTGC
CCAGGGCCTCGGCCTTGCTATGGGTCAGGCCATCGTTGCCAGTGGCGCAGATCTTGCCCTGGTTGACTTGAACAGTGAGG
CTCTTTCTGATTTTACCTGTTGTGATCATCCAAACGGGCTGACGTCTACTAGAGCATGAGGCCCAAGTCCAGGCTGACCT
CATGATGGACGCCTTCGAAGCCAAGCATCCCAACCAAAGGTTCTTTTTTGTTTTCTTTCCTCGCTTCGCTCGCTATTCTT
CTTCTTCCTACCAACGCTCGTTTCCAGCTCGCTCGATATTCTCCTCTAATCTCTTCCTGCTTGCTCATTATTCTTCTCCT
TCCTATTAGCTCACTTCTCGCTTGCTCGTTATTCACCTCCCTCTTGCTAACTCTTATTTTCCGCTCGCTCGCTCGCTATT
CTCCTCCCTCCTAATTCTCCCCTCTCCTCCCAAATTCTCCCTGACTCTTACCAGACCTCCGATCGTCACTGGTCACTATG
CCAACGTCGCCGACGAGACCAGCGTTGACGCATGTGTTGCCGAAGTGGTTGCCACCCACGCAGCCACCATCAGCGGCCTC
GTCACCTCGGCCGGCTTCGTCGAGAACTTTCCGGCCGAGGACTACCCACCCGCCTGTATGCGTGCTCTCTGGGCCGTCAA
CGTTGACGGCACCTATCTGTTTGCCACCGCTGTCGCCCGCCACCTGCAAAATGCCCGAGCAGCAGCAACGGTCGAGACTG
GCACCGGAAAGCAGGTCCCCGAGGCCAGCATGGTCCTCGTCGGCAGCATGAGCGGTGCCATTGTCAATGTGCCCCAGCCA
CAGGCGTAAGTTTTTTTTCTTTCCTCGCTTCGCTCGACTCTTTCTTTCTTTCCTTGCTTCGCTTGATTCTTTCTTCCTCG
CTTCGCTTGATTCTTTCTTTCCTCGCTTCGCTTGATTCTTTCTTCCTCGCTTCGCTCGTTAACTCCTCTCCTGCTCACCC
TCCACAGCCCCTACAACATCTCCAAAGCTGCTGTTCGCCACATGGCCGCCTCTCTTGCTGTTGAATGGGCCTCTGCCGGT
ATCCGCGTCAACTGTCTCTCGCCCGGCTACATGCAGACCCCTCTGACCGCCGCCCTCCTCAATGCCGACCCGGCTCTGCG
CCGCCGCTGGATCACCGGCGTGCCCCAGGGCCGTCTCGGCCTGCCCGCTGACCTCGCCGGCCCGGTCGTCTTCCTGCTTT
CTGATGCTGCCCGCTACGTCACCGGCGCCGACCTGCGCGTCGATGGCGGCTACACCCTCATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62