GenePrediction:GLEAN_4203 Details

Name: GLEAN_4203
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:266142..263852 (- strand)
Length: 2291
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:266142..265526 (- strand)
Length: 617
Type: CDS
Source: GLEAN
Position: GCSC_160:265447..265013 (- strand)
Length: 435
Type: CDS
Source: GLEAN
Position: GCSC_160:264947..263852 (- strand)
Length: 1096
>GLEAN_4203 class=GenePrediction position=GCSC_160:266142..263852 (- strand)
ATGGCTGGCCCCGATCCTCGACGTTCTTCTCGCGCCAGAACCAGCCAGCCACAATCTCGGCCGTCCTCGACCACCTCGAG
CACATCCGGTCGGCCAGACCGCAGCTCTAAGCCCTTTGTCAAGACCGGGTCTCCCCAGAAGTCGACATCTACCGCGTCAC
TCACATCCGAGACACCCGACGACTCGGCCGCCATTGCGGACGATTCTCCACCGCCACAGCCGCGAAGCCGACGCGCCACG
CAGGCTCACAACGCCGTCAAGGACGACTCGCAGGAGCTCTCGTCGGTCGTCGTCAGCGAAATCGAGATGCTGAACGACGG
CGACGGGATACAGGAGGACGATGAGGCTGTCCGCTGCATCTGCGGCTATGAGGAGTACCCCGGACCGCCTTCTCCGGAGA
ATCTTGGGCGGGCGGCCAAGGAAGGGTTCGCCGTTGATTCCATCTTTCCCACAGTCGTCACAGAGGACCTGGCCGGTTTC
TTTGTCCAATGCGACATTTGCAAAGTCTGGCAGCACGGCGCCTGCGTCGGCCTTGTGAACGACGACACCCTCCCTGAAGA
CTACTACTGCGAGGAGTGCAGGAAAGATTTCCACAAAATATTACCGAGCACAAACGGGTAAGTCCCCTTAGCTCCTCTCC
CCCTCTCTACGCCCCTCTGCATGTGTCTGTTTGCTAACGCCATGCGCTACTGCAGACCACGATGCTCGATCTACCAACCA
AATAACAGGAGACGGTCGCGCACAAGCTCATTTGCTAAAGACCGTGATCGGTCGCCAAAAGACCGGGGCAGCAGCAAAGA
CAGCAAGAGCGAAACGAAAAAGGAGGTCGTGCGGGAGGTCAGCAAAGAGACTAAAGAAGGCATCAAAGAAGGTAGCAAAG
ACATCTTGAAAGACAGTGGCAAAGAAGAGATCAAAGATGGAGTGAAAGAGGACGGCAAAGAGGGAAAAAGTGGACGAGCG
ACATCTGTCAGCCAGTCATCGAAACGGCGGTCGACGATGAACAGCCGCGACGCCGCGTACGACGAAGAGCAGCTGCGGAT
AGCAATCGAAGCTAGCAAGGAGGATGTACACATGGAGTCGGTGGAACCGGGCGGAAGAAGGTCGAAGCGCAGCAGAAGCT
TCAGCGACGAGTGAGTCTTTTTTCACCATTATTTGCGGGATATTTGGGCGTGTGCTGACAATTGTGGGAGTACAGGAATT
CAGATGGCGTGAAGCGGCCACGGACGAGCTCGCGATCGGCATCTCCAGGTGGCGAGACGTTCAAGGCTGAAGACGAGTCA
GACGACGGGGCAAACACACGGAACGGAACGTCGAAGAAGGCATCAAGAAGCGCGGCGGCCATACGGAGCCAGCAGCAGAG
AGAAAAGAGCGAGCGGGAAGAAAAGGAGAGACAACGGGCCGAGGCGGCCAACAAGCGTAACGGCAGAGCAGAACGGCGGC
GAGCTGACGGTATGGACGGACTGCAGCCGAGCTCTGTCGTGACGAAGGATGGGAAGACTGACTCGGGCGCAGATTCCGAT
CCGTCCGACGAAGTGCCCCTAGCAACGCGGACGGCGAGCAGCCGGCCAGCGGCAGCTCTGGCGACAGTGACGACGTCCGC
AGTGACAAGCACGCCGCCAGCAGCAGCGCCGGTAGCGTCGTTGGGCGCCACAGCATCGTTGGTAGCGACGCCACGGGCGG
CAGTAGCGCCGCGGCCAGTGCAGCCATCACCAGAAACGCCGCCACCCACATCTGCGCCACCGATGAGCTCTTCCAAGTCA
AAAGGAGGGCGGCCGACTCATAAAAAAAAGGGCCGCAACCAGTACACGAAGGAGCGAGAGGCTCGTGAGGAGCAGTCGGC
ACGGTCGCGGTCTCGTGACGTGGGAGAAAATGGGCACGGCAAGTCCGGATCGGGCGGCGGGTCTGGCGGCGGGCACAACA
GCAAGTCAGGGTCTCGCGGCAAAGGCGGGATGAGCAGCCGGGTGACGATGAGCGAGATGAAGCGGCGTGTGGCGGCGATG
TTTGACTTTATCTCGAAGACGCAGGTGGAGCTCGCGGGCGAAGAAGTGACGGACTCGGCAGACGGGGTGAAGACGGCGGG
ACCGGTTGGCGAAGGACAGCAGCAGCTGGCGAAAGACGAAAGCCAGGCGGTATTAATGTCGGGCAGCCGGTCGCCGGTCA
AGAGGACGACAGAGGGCGCAGAGGGCGAGACTGGCCATGGACGAAACGAATTTACGGAGCTGTCGTGTGTGGAGATGATG
GATTGTCTCACGCGGGACATTGTGCACTGGCAGAGCCAGTTTGCCGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62