GenePrediction:GLEAN_4204 Details

Name: GLEAN_4204
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:241419..237636 (- strand)
Length: 3784
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:241419..237984 (- strand)
Length: 3436
Type: CDS
Source: GLEAN
Position: GCSC_160:237850..237636 (- strand)
Length: 215
>GLEAN_4204 class=GenePrediction position=GCSC_160:241419..237636 (- strand)
ATGTCTGGTTACGCTTATACGTACGGCCAATGGCCGCCACCGCAGCCACAGCCTCAGCCGCCGCAACAGACCCAACAATA
CGCGCAGTTTGACTACCAGCCAGTGGGTAGCACGCCACCGATATACAGCAACAATCCGTACCAAGCAACTCCTCATTATC
CTGCACAGATACCACCACCATCTGCGCCTGCGCAGCTTCATTCTCATGCTCCTCCCCACATTTCCCATACCCCTGACTTT
TATGCCCAGTCGCAAACGGCATATGCCTACAATACGAACAAGACATCTGCTCTGGGGATAAGTGGAATACCGCACGGACA
GTCGCGCGGAGAAGGGCCTCCTGGTGGTGCGGGCTGGATGCAGGGCAGCACATTCGATGCCACATCATCTTCGTTTCCTC
CGCAGTTCCCTGCGAAGAATCAGGAAATCCCTGCTTCGGGCAGTTTCCAGGAGCTTTTTCAACCACACCGCGCACCCATG
CAACACGAGCAGTCATACCCGATCACAACTGCCCCGCCCCTGCAGATTGTGTCGGCTCCGTCTCCTCTGGCCCCCAGCAA
AGATACGCACAACATCCATGTCGAGGAAGGTGAGTTGGAGGAGGGCGAGTTGAGCGAGGGCACGGACATGTATGATCCGC
AGACGGTCACTAGCTCTGCCGTGCTGAGAGAAGATTCGATCTCAAATACGGCACAGCAAAACGACGAGGCAGAAGAAGAC
TTGAAACGCCCATCTCTGGAGCCAGCTGTGGCAATCTACGCCGGTGTCACGGGACAGCCGCCGAGCCGTGATGCCAGCGT
CATTGATCCTCAGGAAGACGCATTCTACGACGAAGATGAAGACGAGGAGCGTGGAGGGGCTGTTGTCATTGGCCACGGCC
CGACCGGCTCAGATGCAGCAGACGCCGACGACGAATATATGGGATTTTCCGATTCAGACCAGAGATCGCCTGTCCAAGAG
CAACACCGCGCTCAATCCTATTCTCCGCATCTCTCGCCTCAGGAAACACGATCAGGCCGACCGGCACCGCTGCAAGACGG
CGAAGGGACGAAAATCAACCCGTTGAAGACGTTGGACGAGAAGACAATGGAAACCGTCCGCCTCGGAGCCTTAGGCTCAG
AGGCGGACGGTTTGGCGAAAGAAGACAGCCAGAAGCTGGTCGCGGAACACGCGAGCCCTGTCAACACTGCCCCGTTTGCT
TCCATTGATGACGCTAAGAAGGAGGCACAGAAGGCTATTCTGCGCCTGATTCCTTACGGCGTCAACTATCAGACGTTTAT
CGACGAGGGTTTCGACGAAAAGACAATCAAGTCACTGTTTGCAGAGCTGGGCCTGAAATCTGCGCAAATGCCCGAAGCAG
AAACTTCACAGCCGTCGCCCAAGCCGGCATCGGTAGCAGAAAGCCAACGAAGCAACAGCGACACGAACGGCCCGAAACTG
GAAGAGAGAAAGGACCGCATTGCCCGCCTTCTGGCTCTCAGAGCCTCAAAGCCTAGCGCAGGTACGCCACCAGCTGTCTC
AACATCAAACGAGGCAGCGGCGCCACCTGTCGAGAAGGCGAAGTTGGAAAAGACGAGGTCGGACAAAGCACGGCTTTTGC
AGCAAAAATTGGACGCTCTTAAGAGGGCACAAGCAGCATCTCACGCTCAGTCGTCTGGTGGGCCGCCGCAGATTCCGACA
TTGTCGGAGTTGCCACCGAATGGCAGCGTCCTGGTCACGCCCTCATCGTCGGCATTGCCACAACGACCGGGACCGAAAAC
GCAAGCATCTCCAGCAGTGCGCCAACAATCTGTGGTCCTGCCTGCGTCGACGATCCCTAGTGTTGTGGCCTCTGGTTCAG
GAACGCCACAGGCTGCAGGCGGATCTCGCAAGCGGCCGGTTGCTGCGGACTTGAACGACTTTTCGACGTTGCCTTCAAAT
CCGCTGAAACGGCCATTCGGGCAGATGCGGCAGGATTCGTCGTTGATCATCGATGTCAGCGACGACTCCGACTCTAGTTC
AGACGTCGAGATGGAGATGGATTCCCCGACGGACGAGCACCCGTCAAAGGCGCTCCAAGGGGGCCGAGCCCGTGCCGGAA
ACTCTGTCCGCGATTTCCCACCCCTCTCAGAAACGCCATTTCAGCCGCGGCCATTTGGACGACTGCCTACGTCCATGCGG
ACTCCACCGAGCGGACCTGCAGCAACGAGGGCCAAAGACGACGAGTACGCGCGGAAGATGAGGCAGATCGAGGAAATGAA
GCGGAAGATTGCCGAGGCTGAGGCCAAGAAGGCCAGGGGCTCGCCGAGCGGATCGCAGACGCCGAGAACAGGCGACAGCA
CACCGCCAGAGGTTGACGCCTCAGCCGCTAAGACGCCCATTCGCCGGGCAGTGTCCTCCAGCGGGATCCCGCAGAGCGCA
GCGCCAGGACTCGTCGAGGCCGTGTCTGCAAGGCTGCCGAAGCCATCGGACAACACGTTTGTGGCGGCAGACGCGGCCAG
ACGTGCACTGAGGACACGTATTGCCAGCCAGCAGCTGCCACGGGTGGAAGCCACGCTGAAGGAGAAGATGTTCAAGCTCA
AGTTGCTGCAGGATAAGGTGGCAGCGCTGCAGAAGGAGATCGACGTAGGCATGGCCGAGAAGATGCGGTTGGCAGAGACC
ATGGTCGAACTTGACAAGGAGGAGGTTCCCGCTGTTTCTGACCAGCCACAGCCAACGGCCGTCGACGCAGAAGCTATTCG
TGTGACCGAGTCCCCGACTGCAGATGTGCAGTTGCAGCTGCTAGTGGAAGAGAGCGCAGCCGCGGCTGTCGAGAGCATGT
TGGTAGCAGCGGATGAGTTGACTGAGACGACGGCTGTCAAGGACAGAGCCGAACCGGAGGGCGAAAATCGTGCAAAGACA
GAAAAGCCCGATGCCGGCGAGGAAGAGTCAGCAGCCGAGGACCCGCTGCAGTCAGACACAGCGTTGGAGCAGGACAATAT
GTCTGAAGGCCCATCGTATGAGCCGATGGCTGACGAGGCGGATGAGGTCGACGAGGATGGTGACATCGAAATGGAGGACG
ATGTGGACGAAGCAGCTACCGAGCCAACAGTCGAGGCAGCGCCCCTCGAAGTGCTTGCTTTGCCCATCTCACAACCTCTT
GACGAAAACCCGGTTGGCGATCTGCTTCAGCCACAACAGCGTCAGAAGAGCAAACAGCTTCCCGACATCGGAAGCTCAAA
GGCGCCGCCGCCAGCAATTCCGGCCCTTGAACCCTACGAGAGTCCGTTGAAGTGCTTCCGTTCCTACCGATTCCACCCGC
AGTATAAATCCGACGTGAAGGGCGGCCTGAAATCATTAACCTACAGTGGTAGGATTGACCCCGACGTCGAGCTGTGTCCC
TACGAGCTCAGCGGCCAGGCCTGCGCGGCGGCTCCAGACTGCCAGTACCAGCACCTGTCGTCCATCGTTCCCAAGGGTGA
GTGTCCTTGCTTTCCGTCCCAGCATTGTCGTTTCTGCTGCCCGTCTGGTATCCTGACCTCCATCCCCCCCTGTGACCGCT
GACGTACCTTGCTTTTCTTTCCTTGTCGCTTCTTGTTTGGAATATCTAGATGACCAAATCCTCGTTGAGCTCGGCCGGTC
CGACGATTTCACCGGCGAACAGAAAGCCAAGTTTGTCACGGGCCTGAGAGACGTGTTGAAGCGATTCCGGGATGCCAAGG
TGCGCGACTTTGACACAATTGCGTACGAGATTATTGGCTTCCGACGCCAGTTCCTGGGCGATGATTCCAAGGTCGTGTCC
CACCTTGAGGACGTCACGGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62