GenePrediction:GLEAN_4206 Details

Name: GLEAN_4206
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:227840..224681 (- strand)
Length: 3160
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:227840..227722 (- strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_160:227525..227474 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_160:227412..224927 (- strand)
Length: 2486
Type: CDS
Source: GLEAN
Position: GCSC_160:224867..224681 (- strand)
Length: 187
>GLEAN_4206 class=GenePrediction position=GCSC_160:227840..224681 (- strand)
ATGGAGCACGGCAGACCCGAGGCGGCCCTATTTTTCATCACGCTCTCATTTGGCTCTGGTTGGGAACTGCTTGGGTTCGG
TTACTGCCAACCAGAAAAGCGCGGCTATCCCATCATCAGGTGAATGCTCTCCTTGTTGTCGCTTCTCTCTCTCGCTCTCT
CTCTCTCTCTGTCCTCTGTCAGTTCATCTGCATCTGCAACAGCTTCTGCTTACTCTACCAGCCTAACGTATCTTACTGTC
CATCTCGACCCAGTCTTAAAGGGCCACTACACCAAATCTGTGCTCCTGTCTCGGGGCCATGACCAGCTGATCCAGGCTGG
CTCCCCTCTACAACACGATCTGCTCGACGGCCTCGATGGGTTTATTTGTCCGTGCTTCGGCCCGCTCGCCTGGCTCTCGA
CTTTTCACGCTGACCCTCTCGCGCACAGAACCGAAGATCTGGTCCTCGTCCGGCCCCGAGGCTGCCGGCAGACGAAAGTC
TGCACGGGATCCGCAACGCCCTGCGCCGTTTAGTCGAGACCTCGACGCTCATCTCTCCACCGGCCGACCATGGCCCGCCG
GAACGACTGCACGTCACGATAGCAGTGGACCGGCCGACGAAGCCGACGAACGCGACCGCGGCCATGCCTATCATCGTGCT
CGGCCACAGCACGTTGGCCCGACTTCAGAGCGTGTTCCAGGACATGTGTCGACGCACGCTCTCAATCGCCCTGATGCCGC
TGGCGCCCGCCATGATGACGCAGGGCCACACGCTGACGCAGGTCCGGCTGGCACGCTTCCTTCGCGACGTACAGGAGGAG
CCACGACTGCCGGCGCTGACCAAAGACCGCTACACGTTTGAGGACTTTCTCGAACTGCTGGCCCTGTCGGCCGGCTGGGA
CGCCCAAAAGCTGCCGGACGCCAAGGACCTGGACACGTCGCACCCGATCTCGCACTATTTTGTCAGCAGTAGCCACAACA
CGTATCTGGTGGGCAACCAGCTGTCGTCGGACGCGTCGGTGGACGAGTACCGCAAGGTTCTGGAGCGTAACTGCCGCTGC
ATCGAGATCGACGTGTGGAATCCGCCGGCCAGAAGCGGCCGAACAGGCGGCCGAGGCAGTGGCCGGACAGCAGCCCATGA
CCGGTCCAAGTCGCCGGGCAAACAGCTGCACGGACGGCACACACCGTCGAACTCAGTGGCCACGTCGATTCAAGAAGGCA
TCGACGCGGTGGCGAGCCTGATCACAGGACGGACGACGCTCAGCCGCAGCCGAGCGTCCAGCACGAGCCAGGCACCGCCA
GCCGGAGAGACCAGCACGCAGGAGACTCTGCTGCAGCGGTCGATGGCGACGACGGCAATCGAGGACGACGACGCAGCCGT
GGCCGACGCAGGCACGACCATGTCGCGGACGGCCAGCACAGTTCTGACACAGGCGACGACAGACGCCGGCAACACGACGA
CGACCTCTATGAGCACAATGAGCTCCAGCAGCGCCGGCACACCAGAGCCAGATGAACCGGTGGTGATGCACGCACACACG
CTGGCCAGAAGCGACTGGACGCTGGGAACACAGGTGCCGTTCCGTGACGTGTGTCGAGCAGTGCGCAGCGCCGCGTTTGC
CGACAATGACCTGCCGCTGATCGTCAGCCTGGAGGTGCACACAAACGCAGCACAGCAGCGCCAGATGGTCAAGATCATGC
GCGAGGAATGGGGCGATCTGCTGCTAGACCAACAGCTAGACGGCACCGATCCACGGTTGCGTCTGCCCACACTGGAAGAG
CTGAAGCGTAAGATCCTGGTCAAGGTCAAGAAGCCGGCAGTGGCGACGAGTCTTGCTGGAGGAACAGGGGCAACTAGCGG
GACAACAGCAACTACTGCCACCACTACTGCCACTATCACTACTACTACCACCGCCACCACAGAGGACTCCTTCACTCCTC
GGCCAGCCCTACACCACGTCGTCGGCCTGGGCACGTCGCTCTTAGCAGTAGCCAACAACGCCGGCGCATTGTCGGGCTCC
GAGGACGACGAGCCAAACGCGGCGCCAGTCTCGGCTTCCTTACCGCCGAGCTCCATCACACACGAGCTCGGCAGCCTGGC
CGTCTACACAGAGAGCCGGCGGTTCACCAACTTTAGCGATCGGGCGGCCAAGCTGCCAGGCCACATCTTTAGCCTCGACG
ATACCGTCATCCAGACCCTGCACGGAAAGCAGCACGAAGAGCTCTTCCAGCACAACAAGAAGTACCTGATGCGCGCCTAT
CCCAACGCCACGAAACACGTCTCCAGCTCGAATCCGGACCCGGCTCCATGCTGGCGACGCGGCGTCCAGATGGTCGCCCT
CAACTGGCAGACCCTCGACAAGGCCATGATGCTCAACCACGCCATGTTTGCGGGGTCGCCGGGCTGGGTCCTGAAGCCGC
CGGGGTACCATTCCAGTGGTGGTGCTACTGTTACTGCTGCTACTGCTGCCACTTCTACGACGACCTGTCCTGTGGCTGTT
GCTGCTCCCGTCTGCACCATCGACCTCTACATCACCATTTTGGCCGGCCAGCACCTGCCCCTGCCGCCGTCGCTGCTGAA
ACGCGGCGGACACCGGCTGGACGAGGTCACCGGCATCGTGAGCGGCCACGCCCGCAAGGACTTCCGGCCCTACGTCCGAG
CTGAACTCAACGTCGAGCGCCCCGATGAGCGCTGTCCCGAGGTGGCCGATTGCGCCTCGTCGTCTGCTGCTGCTGCTGCC
GCCACCACCACGGCCCCGGCTACGTCGACTTTCGCCTCGATTGCCTCTGTCTTTGGCTCTGCCGCCGTGCCCGAGTTGTC
ACTGAGGCAGAAGACCGTTCCCGCCCGGACAGACCAGCCCGACTGGGGCTCCCGCGGCTCCGTGATGCGCTTCAGAAACA
TCGCCGGCATTGTCGAGGCACTCAGCTTCATTGTGTATGTCTACCTCTCTCCTCGCTCTTCTGCCCTCCCAGGCGCCCTC
GCTGACAAGACAGATTCTGTGTCGAGGACGACGGGACCCGGCCGACCGTCTCTCTGGGCCGCAACGACGCCCTCGCTGGC
TGGGCCTCCTTCCGGCTGGATCAGCTGCGGACAGGCTATCGCTTCATCAGCCTGATGGATGGCCGCGGCAATCCTACCGA
TGGAAAGCTCCTCGTGCTTGTCGAAAAGGTCGTCAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62