GenePrediction:GLEAN_4207 Details

Name: GLEAN_4207
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:217865..217554 (- strand)
Length: 312
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:217865..217722 (- strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_160:217652..217554 (- strand)
Length: 99
>GLEAN_4207 class=GenePrediction position=GCSC_160:217865..217554 (- strand)
ATGGACCGCACACAGATCGCACACCTGGATGATGAGAGCTTTTATTCGGTTGAGGATACCTTGCCCGATCCATTCTCGGC
CATGCATCCAAACCCTCGCTTCCACATCCCGGCGAACGGGGATGAAGGCATTCGCAGTGTACCTGTAAGTTCTTCTTGGG
GGATGGGGCTCTACATTTGTTGAAAGAGCTCTCGAGACTGACACCTAATGCAGCTTCCCGGTGTGCGTTGTCCAAAGTGT
GCCAAGGATGGCAAGGAGGTCTGGGTGATACCTGGCCGTGCCTGTGGCTACTGTGGCACAGCTTGTGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62