GenePrediction:GLEAN_4208 Details

Name: GLEAN_4208
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:212767..210447 (- strand)
Length: 2321
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:212767..212749 (- strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_160:212684..212648 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_160:212583..212305 (- strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_160:212241..210447 (- strand)
Length: 1795
>GLEAN_4208 class=GenePrediction position=GCSC_160:212767..210447 (- strand)
ATGTTTTACAGCACTGAAAGTATGTCGTGTCCACACAGGCCTGAATATTGGCTGCGATTACCTGCTGACAGCGATCTGCA
CAGTTCTCTCAAACAAGGGCTCTGCTTTGTCCACAGTTTGGTAAGCCTGAATTACGTCTGCTCCTGGCAACACCGTGTTA
CCGCTGCAAACTGACTCGGCCTAGGCGGGCTGGCAACACTGCTCCTGGCGCCTCAAACACCGGCATTCGGCGCAAGGCCG
TTCTCGAAGTCGACATTGAGCAGGCCTGCGGCACCATCATAGAGCCACCGGGCGCCCCGATCGCCTTGCGTCTGCAGGGA
ACGCTCTTATACGGCACTGCTCGCATCTACCAGGAAAAGTGCCGCTATGTCCTCACTAACAGTGAGCGAATCCAGCGAGC
CATGGTCAAGCTCTGCAACAGCTACCTCGATAGCAAAATCGACAAAAACGCAGGCAGAGCCAAGTGCGTACCTTTTCCCC
ATGCTCTCTTGTCTCTCTCTACCTCTCTCGGCTGACTGGTCACAAGGGGCGTTCAGATCGCTCTCCCGGATGATCCCAGC
TTCGACTTGGATTTTCTGCAGCTGCCGTCGTTTGATTTCAACGCAGCCGAGGGCGTCTCCTTTGTCTCCCAGTCGCGCCA
GGATTCCTGGACAAACATGTCGATCCTGTCTCGCCAGTCCAACCATTCTCTGCTGCCCCAGATTGTCCTCGACGCCGACT
CATCTGGCCCTCACTCGTACGCCGGCGATTTTCAACACCCTGCCTCAGGAGCCTCTAACATGCAGGACTCCCCTACGCCT
TTTGGCCGACAGCTTGGTGCTCCAGAGGAGGAGGACACTCTTCTGGCCGATGTAGGCCTGTTCATTGATGAAAATGGAAA
CATTGTCGAAGAAGAGCTGCGCTCTGAGCCCCAGCTGCCAGCCTTCCCACCGTCTATGTTTGACGCAGGCTCAGATGTCG
CTGCCAAGGCGAATGCAGCTGATGAGCTGATGGTAATGGATGACGACGGACAGATTGTCCCTCCAACCCAGCTGCCTATC
AATGGCCCAGCTGCCGCCGTCACGGCCCCGAAAGCCGTCTGGTCCTCACAGACATCCTCATCCTCTCAGACGTCCTCTCA
GACGTCCTCCTCTCCAAGCACTGTGCAATCCAAGCAAGCACATGCCAGGATCCAGCGGGTGCCCAACTATGTCGATGAGA
TCACACAGATCCCACACGAAGAATATTACAGCTGCGTGAGAAACTATGCCGACAATATGCGGCGAGCGGCAGATCGTAGA
GACCATGCCCGTGCCATTCGACGTGCCAACGATGTTGCCAAGAACAGAAAGACTGCGTACGACTACAGTCTCGGCCGCGG
ACTCTTCAGCATTGCGGGCGATGTCAATCGGTACTGCCCCGACCACCCCCTGGCACAGATGTTCTCAGGCGACGCTCTCG
AGCAGGCACTTTACGGCGACGCACTGCACCAAGCCAAGCGGCGAATCGTTGCTACAGATGAGCCGAGCACACCCGCCAGA
CGTGGTGCCGGGGCTGGTTTTGCTGTTCCGGGCAGCGAGGACCAAGACATCGAACTTGGTCGACAGCCGGCTTCAGCACT
GTCCGACAACCCTTCGCTGCAGCTGAACCGGCAATCGTCTCTTGTTCTAGGCTCGTCAGCTCAAGGAAGTGCGCAGCGCA
GCGCAGGATTGAGCCGTCCACTTCCCAGCAGCGGGCAGCGCAGCGCAGAGCGCGCTCTCGACCCCAGCTTCATTGATCGG
TACAGCGATGATGGCCTTGACTTGTCAGTGCAGCTGCATAGCAATTCCGTTGACGGCTTCCTGCCCCCGGGCAGCTCGCC
GCCTCGACCCGACATCCAGGCAATCAGTGCAGCGATTGGAGAAGAGAAGCAGAGCACCTCTGAATTTCTTGGGCTTGTCC
AGACGAAAGCCACTGCGGAGGGTGTTGTGAGACCCGGCCGCCCAACCCATCTCTGGGTGGCGTTTGACGATATCGTAGCG
CCGTTCAAGGGAAGCACACCGGCTGTGGTTGGCGCCTTTATGAGCCTGTTGTCGTTGGCAAGCTCCCGGCAGCTGCGTAT
CCATCAGGACCGCGAGAACGACGATCGGATCGACAGAAGCATATTCATCGGCTTGAAAGCCTCAGAGAAGCAAAAGCCGA
GGAAGCGGCGTTTCCAAGAGATGAGCGACGCTGGTGTGGCCAGCCAGGAAGACCTCATGAGTGGACATGTCTTCCCGAGC
GCGGTCGAGGCGGAAAATCTAGACTACAGGGACGGAAGCGATATGCAGGATGCAGAGGCAGGGGCCGTCGAAGCCGCTTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62