GenePrediction:GLEAN_4209 Details

Name: GLEAN_4209
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:207540..206470 (- strand)
Length: 1071
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:207540..207244 (- strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_160:207159..206470 (- strand)
Length: 690
>GLEAN_4209 class=GenePrediction position=GCSC_160:207540..206470 (- strand)
ATGCAGCGCTCCGTATACGGACAGTCGCCGCCGTTGCATCATCCGGTGCCGCAACATGTGTCGACGGTGCCGCAGCTGCG
GTCGCCGCCTCTGCCGACCAGCTCCCAGCCTCAGCCTCAGACGTACGGCAGTCCATACCCACAACAGCAGCAGCAACAAC
AGCAAGGCGCAGGCGGACATATGGGTGGCAACATGTTTGGCCAATATGGACAGTTTATAAACGACCCGACAGCACAAGTG
GCCGCACAGCTGTCACAGGCAGCCTTTCGCCAGAGCCAGGAATATATGGAGCAGAATGTGCGTCTCGGCCGCTCTCTCTC
TCTCTCTCTCACTTCTTCCTCTGTTCCCTTTGAAGACTGACATGTATCCCCCCACCCTCAGATCAACCGCTACGTCAACG
TCAACGTGCTCAAGCACTACTTCAACGTATCCAACTCGTACGTGATCAACAAGCTCTTCCTGGTGCTATTCCCGTGGCGT
CACAAGCCGTGGTCGCGACGACAGACGGTCGGCCCGGCTGGCCAGGAGGGCTGGTACCTGCCGCCGCGTGACGACCTCAA
CAGCCCGGACATGTACATCCCCGTCATGTCGGTGGTGACGTACATCCTGCTGTCGACGCTGCTGGCCGGCCTGCGCGGTC
AGTTCGAGCCCGAGCTGCTCGGCTACACCGCGTCCAAGGCCATGGCCGTCACCGGTGTCGAGATCCTCGGCCTCAAGCTG
GGCTGCTACCTGCTCAGCATCTCCAATACGTCGCAGCTGCTGGACCTGGTCGCCTACTCGGGCTACAAGTTTGTCGGCGT
CATCGCCACCATCGCCGTCGCCGAGATGGCCAACGGCGGCCGTGGCACCGGCGGATGGATAGGCTGGTCCGTCTTTTTCT
ACACCTTTCTCGCCAACTCGCTCTTCCTCATGCGCTCGCTCAAGTACGTTCTGCTGCCCGAGAGCGCCGCCGACGGCCGT
GCCGCCATGCAGACCGACACCCGCGCCAAGCGCAACCAGCGCACCCAGTTCCTCTTCTTCTATTCGTACGGCGTCCAGCT
CTTGTTGATGTGGATTCTCAGCCGCACATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62