GenePrediction:GLEAN_420 Details

Name: GLEAN_420
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1664662..1666520 (+ strand)
Length: 1859
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1664662..1666215 (+ strand)
Length: 1554
Type: CDS
Source: GLEAN
Position: GCSC_167:1666284..1666520 (+ strand)
Length: 237
>GLEAN_420 class=GenePrediction position=GCSC_167:1664662..1666520 (+ strand)
ATGAGCTACTACAGCAGCGACGACGACATTGACGTCCGCGTCCGTCGTCGGCGGGACTCTTCGTCGCCTGGTCCCCGGCG
CCCGCTCCGCGGCTATTATGCGACCGGGCCGGTAGCCAATTTTGTGCCGGAACGCACAGTTGAGCGCACGGTGGCGGTGC
GCGAGCGTTCTCGTGAGCGGCGGTCCAGTCCGCCGCCGACTGTGATTGTCAACAACATCACGAATCGTTCGCACGACGAT
GACGACTTTTCTGACGCGGGCACGGGCGTCCGTGGCGGGGCCATGGTGCGGCGGCCACACTCGCGTGCCCCGTCTAGTGA
CTACATGACGCGCGAGGAGTACGAGTTGGAAAAGGCGCGGCGCGAGCTGCAGGACCTCAAGATCCGGCAAGCACGCGCGC
AAGAGGAGCTCGAGCTGCACGTCCGACGCAACGATCGAGAGGAGTGGGAGCTAGAGCGTGCACGTCGGGAGATTGCGGCG
TATCATGCGGAGGAGGAAGAGCGTGCGCGGCGGCTGCGCGGACAGGAAGAGATGGAGACGGCGCGGGCTCTGCATGAGCT
GGAGGAGATCAAGCGACGCGAAGAGCGCGAGCGGATCGAGAAGGAGCGCGAGCGGATCGACAAGCTGCGGGAGAAGGATT
ACCACAGCCAGGCGGAGCTGGACCGGGCGAAGCGCGAGCTGGATGAGATCAAGAGCCGTGAGGATCGCGAGCAGGCCTTG
AAGGAGCGTGAGCGGTTGGAGAAGCTACGGGAGAAGGAGTACCGCAACCAAACAGATCTGGAGCGAGCCAAGCGCGAGCT
AGACGAGATCAAGAGCCGCGAGGAGCGGGAGCGGGCAGATAAGGAGCGGGAGCGGATCGAGAAGCTGCGGGAGAAGGAAT
ACCGCAACCAGACGGAGATGGAGCGGGCCAAGCGAGAGCTGGACGAGATCAAGCGGCGTGAGGAGCACGAACGGTCAGAG
AAGCTGCGGGAAAGCCAGTACCGCAACCAGACAGAGCTGGAGCGGGCGAAACGCGAGCTGGACGAGATCAAGCGGCGCGA
GGAACGCGACATGGAGGAGAAGCGGCTGAAGAAGGAGCTGGAGCTTCGGGCGCTGGAGAAGCAGAAGCGTGAGATGGAGG
AGCAGGCAGAGCGCGAGCGGCTGGAGAACGAGACGATTGCGCGGTACAAGGCCAGAGAGGCGGAGCGCAAGGCCAAGGAA
GAGCGCGAGCGGGCAGAGAAGGAGAAGGAGTACCAGCGGCGACTGCGCGAAGATCTGGCGCGATCGGGACTGGACGAGAA
GGAGATCCAAGCGATCCTGGAGAAGAAGAAAATCAAGCGCGAGAAGGAAGAGAAGCACGAGAAACACGAGAAGCAGGAGA
AAGAGAAGCACAAGGAGGTGGTCGAGGTGGAGACACGCATCTCGACACGGCCACCGATGCCGATGCCGATGCCTATGACG
ATGTCGATGCCAATGCAGCCACCAATGCAGGCGCCGACATATACGCGGATGGCCCGGCGGCACCTGTCGATCGAGACGCT
CAACTACTATCACGTGGACTACGACTTCGACCAGGTAAGCGGCGAGGAAGGGAAGATGAGCAAAACGAGCAGCGACGTGT
GCAGACATGCTGACAATGGCAGGATCCGAACTACATTCTCATCAAGCGCTGGGTGCCAGAGAACGAGCGGGAGGATTGGT
GGCAGCACACGAAGACGATCCGGGAGAACCGCCGGGTGGTGCTGAAGATCGAGGACGAACGCCATCACCGCCACCATCTG
GAGCCGGAGTACGAGTGGGTGCGCAAGAAGGAGCGGCGCCACAGCCGCAGCCGTAGCAAGTCACCGGGCCTGCTGATGTA
CCTGGCAGGGGCGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62