GenePrediction:GLEAN_4210 Details

Name: GLEAN_4210
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:205716..204964 (- strand)
Length: 753
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:205716..205621 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_160:205534..205455 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_160:205402..204964 (- strand)
Length: 439
>GLEAN_4210 class=GenePrediction position=GCSC_160:205716..204964 (- strand)
ATGTCTTCTCCCATCGTCACCACCACCACACAGGCTGCCGTCTTCAGCATCGTGTCGAGCGTGTTGGCCCAAGGCATCAC
GGCCTACCAGTCCAATGTGGGTAGAGCAGGAAACAAGCAAGCGCACGGATGAGGGCAGCTACTTCACCACCTCTCAAGCC
ACTCTGCTCACCGTCAACACAGTCTTCCCTATCGCTCGATTGGCATCCCGTCTTCCAGTTTTTCATCTTTGCTATCATTT
CCACCCCGCCAAACGTCCTGTGGTAAGTAGGCAGCCCCGTCGTCTGAGCCGCCGCCGCCCTAACGAGCAATAAGGCAAAT
CTTCCTCGAGTCTTCCTTTCCCGGATACTTTCAAAAAGAGACGCAGAAACAAAAAGAGGACACCGAAAGCACACAAAGCA
AGGCGGCCCTGCCAGAGCGCCTCAACTGGCGCAATACCCTCACCAAGACACTGCTAGACCAGTCCGTCGGGGCCTGTGCC
AACACCTTCTTGCTGTGCGCCTTTATCGCTACCTGGGAGCAGGGACTGCAGTCAGCTACCACATCCATTGCCGCCGTCGT
CAGTCGAACACGTGCCGACTTTTGGCCCCTCGTCTTTGCCGGCTGGCGCTTTTGGCCGTGGGTCAGCATCAGCAGCTTCG
CACTGGTCCCTGACGTCGCGACACGGAACCTCATCGGTGGCCTGGCTGGCATTGTCTGGGGTATTTACCTCAGCCTGGCA
ACCGGTCCCTCGGTCAAGGTGGCGACTGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62