GenePrediction:GLEAN_4211 Details

Name: GLEAN_4211
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:184819..182635 (- strand)
Length: 2185
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:184819..184563 (- strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_160:184508..184375 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_160:184098..183915 (- strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_160:183855..183514 (- strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_160:183457..182635 (- strand)
Length: 823
>GLEAN_4211 class=GenePrediction position=GCSC_160:184819..182635 (- strand)
ATGATCGATCTATCATCCTTCGGGCCATGCCCACCGACAACCCGAGAGCTCACACCGCGCTTGCAGGCAGTAAAATACGG
GAAGTCGGTCAGCTTCGATGACCTGAATCGCTACGAAAGTGCTGTCACCCGCTCGTCTGATGGCCTCAGAGAGCTGCGGC
AGACAGAGGCTCAGGCCGCCCAGGCAAGGGCAGCAGCGAGTGTTCCGGCCACTCAAATGTGCAGCCAGAGATGGAGGCAG
GCCCTACTGATGGCATGGTAGGCCTCACAATCCAACATTGACCAATGGCAGGTTTTGCTAAGCAGGAACAGCATCTTGAT
CGGCTTCTTCTTCTCTCTCCTAGATACCACTATTGTATCGACTTCGCTTCTTGCCGCATCGGAAGATCTCAGCGGTTTCC
GCGACTCTTCTTGGGTGGTCTTGGCTTACCTGCTGACTTATATGGGTGTGTGCTGTCCCTTGTATGAGTTATGCATAGCC
GTTGATCGTCTAGCTAATTCTACTTCTTCAATCCACGGCAGGCTTCTCGATATTCTTCGCTAAGCTTAGCGACATATACG
GCCGCCGAAACATCCTAGTCGTATCGTGGATAATATTTGTGATCAGCTCTATCGCATGTGGATGCGCTTATAACATGTTA
CAACTGTGTGTATACTCAGCACTGACACCCGCTATCACCTATCTTAACAAGACTGTAGGATTGTTTTTCGTGCATTTCAA
GGGATCGGCGGAGCGGGTCTCTACAGCCTGACCACGATTGCCCTGCCGGAAGTTGGCCCCGGTCATCGCCCAGAGATTAT
TGGCAAGATTATCGGCATCACACTCTCCGTGTCGTTCATCATTGGTCCGATCCTCGGCGGTATTATACCGCAGATCTCGA
CCTGGCGCGTGATATACTGGCTCAAGTAAGCTCATCTTCGGTTGTTAAGGTCGGATGATGAAGACTGACGCTCTCCTCAT
GCAGTGCTCCGTTTGCCATTGTCACCATCACAGGACTCGTCTTTCTGTTTCCCCCGGAAAACCGAAGCCGGCTTGGCCCA
CGCCGTTCTCTTGGCAGACTCGACATCATCGGAAGTTTTTTGCTGCTGGCAAGCACGGTGTTGCTTGTAATTGCGCTTCA
AGAGGCTGGCTCGCTGGTGGTGGCATGGAACAGCCTGCTGGTTCTGGTGAGCCTGACGCTGGCGGCAGTCAGCCTTGCGC
TGTTTATAGGCTGGGAGTCTCTGCTATGGTCTGGAAGCAATTGGGGGATCGAGCCTGTCTTCCCCCTCCGGCTCTTGCAG
AACCGGGTATATTCTGCCTGTCTCATGTACGGCCCCCCGCTCCTCAAGTCGGCAAGCTTGACTGACATGCTTGATACAAT
AGTGACAAGTTCTTGATCGGCTGCGTGTATCTCTGCCTCGTTATCACCGTCCCGCAGAGATTTCAGATCGTCAATGGTGC
GAGCGTGTTCAAGACGGGCGTGCATCTGTTGCCGATGCTTGGCGGCACAGCTGGCGGCTGTCTCGTCTCGGGCCCGATTA
ACGCGAAAAAGAATCGGACGGCGCCAGTGGTTGTTGTTTCGTGTGTTTTCATGGCCGTGAGCACCAGCCTCCTGGCCACG
GTCAACAGAATCGACTACCCGGCAGGCCCAATGTACGGGTTCCTGACACTATTCGGGTTTGGGTTTGGGCTGTTCATGTC
CGCCGGCACGATGCTGTCAACGGCGCAGGCTTCAACGGGAGACCATGCCGTAGCCCAAGGAGCGATTTCGCAACTCCGAC
TTCTAGGCGGCATCCTTGGGCTGACCTCCTTCACCATCATTTTTAACAGCTCCATACAGTCGGCCGACATGGCGGACGGG
CTCAGTCCCGGACAGTTGGAGGTGCTGCGGCGCTCGCCGTCGGCTCTGGTCGAGATGTGGCCAGAGCTGCAGGACCTGAT
TCGGGGCACATACTGCGCTGCGTTCCACAAGATGGCATCGATCATGGCAGGGGTCACGGGACTGGCACTGCTGGTCAGCC
TTGGGACGCTGGAGAAGAGTCCGCCTCCAATACACGGCAGTCTGGCGGACGAGAAGGCGCATTTTCCCGATCGGGGAACG
AGCGACATGAAGCTGGATGACGAGGCTAGCGACCGATCCCTCGTGGCGTTTCATGTCCCGGTCGTTGCAGAGCCATTGCC
AACACTGTCGACAAATCGGCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62