GenePrediction:GLEAN_4214 Details

Name: GLEAN_4214
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:175162..172412 (- strand)
Length: 2751
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:175162..172996 (- strand)
Length: 2167
Type: CDS
Source: GLEAN
Position: GCSC_160:172929..172412 (- strand)
Length: 518
>GLEAN_4214 class=GenePrediction position=GCSC_160:175162..172412 (- strand)
ATGATGCCTCTCCCGGAGACGAGGCCGTTCTCGATGGCGGTGCGGACGGGCAGTTCGAGCTCGCTGCTGGCGCCAGTGCG
GGAATACGATGCAGACGCGGTATCGATCCGAAGTGAGCAAGACAGCGACAGCGAGGACGACGAGCTGCAGCTGCGGGCGC
GCAACAGCCGGGAGCTGCGAGCGCACGACCGGCTAGTGTTTATGGAGGAAGACGAGACGGACCGGCTGGTGACGAACGCA
CGACGGCGAGAGCAGGACGGCGGTCGTCGGGGCAGCGGATTGGCAGCCGTAGCGGTTGCGGTCGCGAAGCCGCTGCGACT
GCTGGGCGTGCGACGAACGAGCGACAGCAATGGTGGCAGCAGCCGGTCTCGCAGTCCGAGCAGCCGAACGAGCGGCCGGC
CGGGCACGGCGACGAGCCTGCTGAGCGTGACGAGCGGCACGGCCGTAGGCTCGACCGACAGTCTCTTGGCCGATGACGAG
GGCCAGGCAAGTCAGAAGAAACAGCAGCAGCAGCAGCAGCAGCAGCGACGACAGCAGAGGCGACAGCGACGACACAGCAA
AAAGTCGCGGCTGCTGGCCAAGGCAGACCGGGGTGAGGACGGCGAGCTGCTGTACGAGATGGAGGAAGGCGGCATGAAAG
AAGGCAGCTCGACGGGCGACAGCAGCAGCCGGAGCCGGAGCCGGAGCTACAGTCGAAGCAGCAGTCGGAGCAGCAGTCGG
AGCAGCGACGACGACCACCACGACCAGCAGCACCTGCTGCCAGCAGTCAACGGAGGAGGCGATTTCGGCAGCAGCAGCAG
CAGTCGACAGAAGCGCCAGCAGAAGCGACGACACTGTCGCGGCTGCACCTGCTGTCTGGGCTGTGGCGGCTGCTGTGGCC
GCTGGGTGCTAGTGCACCTGCTAATCGTCGTGGCTTTTGCCCTGCTGGTGCTGGGGGCCTGGAAGCTGACGCTGGACCGA
CGACGTCGCACGGCCGCACAGCCCACACAGACACGACCGCTCGTCAGCAACGGCACGGCCCTCTTTGCGCCGACGACGCT
GCTCATCAGCCTGGACGGCTTCCGAGCCGACTTTCTGCAGCGCGGCCTGACGCCACGGCTCAGCGCCCTCGTGCGCGAAG
GCGTCTCGCCAGCCTACATGCTGCCGTCGTTTCCGAGCGTCACCTTTCCGAACCACTACACCCTCGCCACCGGCCTCTAC
CCGGAGAGTCACGGGGTCGTGGGCAACACGTTCTGGGACCCGGCCCTGCAGGCCGACTTTCACTACACCGACCCAGCTCG
CAGCCTCGACCCCAAGTGGTGGGCCGGCGAGCCGGTTTGGGTCACGGCCGAGCTGGCCGGCGTCACCACGGCCGTCCACA
TGTGGCCCGGCAGCGAGGCCCATATCCTGGGCGTCGAGCCGACGTACGTCGACAAGTTCAACGGGGACGAGCCGCTGTCG
AACAAGGTCGCCCGCATCCTCGACTTTCTCGACAAGCCGGGCGAAGAGGCCAAAGTCCATGCCAAAACAAAAGACAAAGA
CAAGGACAAGACCCGTCCGCAGCTCATCGCCGCCTACGTTCCCAACGTCGATGCCGACGGCCATCGCTTCGGCCCCAACA
GCACCGAGATCCGCTCGACCATTGCCGCCGTCGACGCCATGCTGGACGACCTCTTCCGCGGCCTCGAAGCCCGCAATCTG
ACCGACATTGTCAACGTCGTCGTCGTCTCGGACCACGGCATGGCCACCACCGACGTCAGCCGCCTCATGCAGCTCGAGGA
TCTCGTCGGTCCGGCTGGCATGGACCGCATCGCCCACGTCGACGGCTGGCCTCTCGTCGGCCTTCGCCCCAAAACGGACG
CCGACCTGCTCGCCCTCCACGCTGACGTCCTCGCTGCCACCGCCGACAACCCCAACGTCGACGTCTACCTCCGCGACGTC
GACATGCCCGCCCGCTACCACTTTTCCCGCAACCCCCGCATCGCCCCGCTCTGGCTCGTCCCCAAGACCGGCTGGAACAT
CGTCCAGCGCGACGAGTTCGACGTCGCTGAAGCCCAGGCCGCCGGCCTCGTCTATCATCCCCGCGGCCTTCACGGCTACG
ACCACGAACACCCCCTCATGCGTGCCATCTTCGTCGCCCGCGGGCCCGCCTTTCCCCACGCCCCCAACAGCCGGCTGGAC
GTGTTTCGTGCGTGTCCCGTGTCCCGTGTCCCGTGTTTGTTGCTTATGTAATAACTGACTAATCTTCTCCCAGAAAATAT
CGACGTCTACAACATCATCTGCGATTCCGTCGGCCTCGAGCCCAAGCCCAACAATGGCACCCTGCGCCTGCCCCTGGTCC
CTGTCGGCCTGCACTCTGACGATGCCACTATACCGCCCGCTGATCCCGTCACAGCCTACACTCTCACGACAACGGCCTCG
TCTACGGCCTCCACGTCTACGCTTTCCACATCTACGGCTTCCACAATTATTGCCTCCTCTTTAACCACAACAGCCTCCAC
ATTTACAACAGCCTCTACGTCCACCTCCGCAACAACCTCCACATCTACAACAGCTTCCTCGTCTTCAGCTGCTATAGCTG
TAAAGCCCACCACCACCGTTGCAGAGACCACCACTGCCACTACTACAGTCTCCACACCTTCCTCCAACAGCACCACCGCC
GCAGACGACGTCAAGGCTGCTGCAGACGACCTTTGGAACTGGTTCACCGACAAGATCGAAGACGCCTGGAACAAGATTTC
TGGCAGCTCAAAGACACAATCTTCCGGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62