GenePrediction:GLEAN_4216 Details

Name: GLEAN_4216
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:158203..157783 (- strand)
Length: 421
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:158203..157937 (- strand)
Length: 267
Type: CDS
Source: GLEAN
Position: GCSC_160:157863..157783 (- strand)
Length: 81
>GLEAN_4216 class=GenePrediction position=GCSC_160:158203..157783 (- strand)
ATGGGTGCCTTCCAGCGAAAAAAATTCCAGTCATCTGCGGATGCGAACAAATTTGCGTCACGGTATCGGGCGGCCATGGC
CAAGCATCCGTTTCTGCTCTTCGGCCTGCCGTTCCTTGTGGTCATGGTCGGCGGGTCGTTTGTCCTGACGCCGGCGACAG
CGATCCGGTACGAGCGACACGATCGCATGGTCCGGCAGCTGTCGCGTGAAGAGGAGCTGGGCATTGGCAAGGGCGGGCGC
AGGGCGGACATGCGGGAGGAATACTACGTGAGTTCTATCTGCCTTCCTGGCTGGCCGATATAGATAAGATGTGGACCGAC
ACTGACACCGACGCCGACAGAGACTCGCCCACAAGGACCTGGACAACTGGGAGCAGAAGCGGGTCAAGAGGCTCAAAGGC
GAGAATGACGGAGTGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62