GenePrediction:GLEAN_4217 Details

Name: GLEAN_4217
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:156847..154199 (- strand)
Length: 2649
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:156847..155078 (- strand)
Length: 1770
Type: CDS
Source: GLEAN
Position: GCSC_160:154963..154199 (- strand)
Length: 765
>GLEAN_4217 class=GenePrediction position=GCSC_160:156847..154199 (- strand)
ATGTGCGCGACCCTGCTCTCAGCCGTGCAGATAGCCGAGCCCGATGTGTCGGCAACACTGGCGCCGTTGGCCATCGCCGA
GGAGCCGCTGTCGAGGAAGCAGTTCACGGCCAACGTGGCACGACGGCTCAGCGGACGAGCAGCGGTGCCGTCGGGGACGC
CGTCATCGCGCAACTCACTGATCAGCCAGCCGAGTACGGAAGCTGTGAGCCCGCACATGACGGGCTCGCCCATGCAGATG
GCTGCCGACGAGGCCAAGCCGGCCCATCATCACGGGCGCCGCAGTGTTGACCAGGCCAGCGGACGGCTGCTGGCCCAGCT
GGCCGAGTGGCTACAGTACGAGAAGGAGAAGAAGGAGAGCCGCAAGTCTCGCCGGGTGCCGCGTGTGCACAACAAGAAGA
CGAGGTCGCCTCCGTCGGACGACACGGGCGAGAAGGCCAAGGCGAGCAGCAAGGGCAAATTGTGGGAAGGAGCGGCCATT
GATGAGTCAGCAGCGATAGTAGTGCCAGAGATCAAGCACACGCGGTCGCTATCGACAGGCTCAGCGTCGAGCGACATGTC
GCTGGACCGGCTGCAGCGGATCATAGACGATGGGATGGCGGCCATGGGGATCGAGTCGCTGTCGGGGTTGGCAGCACGCG
GACGAACATCGAGCAGTGGGCGGCGGCATCACTCGCGCAACCGGCGGCACCAGCCGAGCCAACCGAGCCAGCCGAACCGG
ACGGCGTCATCAGACACCGACTACGTGGACGGCGACGTGTTTGTGCCGGGCTGCGACGCGGTGTTGGACAACGCTAAGAC
GCTCAAGTACGCGGCGAGCAGTAGCAGCCAGGGCCAAGGTCAAGACGCGGGCAGCCGGCGGGAAGAGAAGGAGCGCGCGG
CGTGGGTGAGCTTCAAGAACGAGATCATCCGGCTGGCCCACACGCTGCGGCTCAAGGGGTGGCGCAAGGTGCCGCTAGAC
GCGGGCGAGACGATCACGGTGGAGCGTCTGAGCGGTGCGCTGACGAATGCGGTGTACGTGGTGCTGCCGCCATCAGACGT
GCTGCCGGCGAGCACAAGCAGCAAGACGAGTCCGGGAGCGGCGAGCGCGGTGGCCATTGCGGGCACGCCGGGGTCGTTGT
CGTTCCAGGGGGCTTCCGGAACTTCTGGAACTTCCGGGACTTCCGGGACTTCCGGGACTTTCGGGGTTTCCGGGACGTCT
GGCCGTCGCAACCAGCCGAACAAACTACTCCTCCGCATCTATGGCCCGCAGGTGGAGCACTTGATCGACCGCGAGAACGA
GCTGAGCGTGCTACGACGGCTGGCGCGCAAGAAGATCGGCCCGCGGCTGCTGGGCACGTTTGCCAACGGGCGATTCGAGG
AGTTCTTTGACGCGTCGACGCTGACGTGCGTCCAGATGCGCGAGCCCGACACCTCGCGGCAGATTGCCAAGCGCATGCGC
GAGCTGCACGACGGCATCGAGCTGCTCGAGGACGAGCTCGCGGCCGGCCCCAACGTGTGGCGCAACTGGGACCGCTGGCT
GGATGCGGTCGAGCGCATCGTCTCGTTTGTGGACCGCGAGGTGCTCGCGGCCCAGCAGCTCGTCGCCAGCGGCTGTACCC
CAACACCAATGTCTCGCGGCATGGCCGATTCCTGGAAATACCGCGGCTTCGTCTGCGGCGTCGAGTGGCCGGTCTTCCGC
GCGGCCGTGGACAAGTATCGACAGCACGTGGTGCAGCATTATGGCGGCGAGCGGAAGATGCGCGAGAAGCTGAGTTTTGC
GCATAATGATGTAAGTTTTGGGTTTTTATTTATTTATTATTTGGTTTTTCCCTGTTTTACCTCCTTCTTTCTTCCTCTTC
TTCCTCCTCCCTCCTTCTTCCCTCCTCCTCACTCACACTCCCAGACACAATATGGAAACATCCTGCGGATTCGCCCCAGC
GACAAATCCCCCTTGCTGCAGCCCGGCAATGAACACAAACAGCTGGTGGTCATCGACTTCGAGTACGCAGCAGCCAACCC
GCCCGGTGTCGAGTTTGCCAACCACTTCACCGAGTGGGCATACAACTACCACGACACCGTTGCGCCGCACGCCTGCGATG
CCGCCAAGTATCCCACGCCCGAGCAGCAGCGCCACTTTCTGCGTGCCTACGTCGAACACCGCCCCCAGTTCCCCCACCAG
TCGGGCGCCAATACGCCGCGCTTCGGCCCCGTGTCGCTGCCATCGCCACCGTCGCTGTCGGAGCAGCCGTCGGCCAGCTC
GATCGCCGAGTTCATGCTAGACGCCCGCGCCCCTCCTGGCGGCTGGAAGGAGGAGGAGCGCCGCCACGACGAGCTCGCCG
ACAGCCAGGTGGAAGCCCTGATGGCCGAGACCCGTCTGTGGCGCATCGCCAACAGTGCCCAGTGGGTCGTCTGGGGCATC
GTGCAGGCCAAGGTGCCCGGCCTCAGCCTGGATGACGCCGCCGACGGCAACGACAACACCAGTGTGGCCAGCAGCACCCA
CAGCAGCGACGATGTCGAGCCGACCGTCGACGAGGATGGCTTCGACTACCTGGCCTACGCCCAGGACCGCGCCCTCTTTT
TCTGGGGCGACTGTGTCCAGATGGGCATTGTGCGCCTCGGCGACCTGCCCGCAGACCTGCAGTCCAAGATCAAGATTGTC
GAGTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62