GenePrediction:GLEAN_4218 Details

Name: GLEAN_4218
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:151591..148985 (- strand)
Length: 2607
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:151591..150360 (- strand)
Length: 1232
Type: CDS
Source: GLEAN
Position: GCSC_160:150296..148985 (- strand)
Length: 1312
>GLEAN_4218 class=GenePrediction position=GCSC_160:151591..148985 (- strand)
ATGATTGCTAACATGCCCCTCCGACAGAAGCCCAGAGATGATCACGTCAAGAGCGCTCATGCCGGTTTCAAGCCGTGTAC
TCCGCATGAAGCCATGTTGAGGGCTTCCACAACATTTCTGGACTGGCCGTGCTCTGCATCAAGCCCGACTTTCACCGCGG
GATCCATGCAGCCTCAGCACGCCGATGCAGGCGTGAGCCTGCACAACATGTCGCATAGCAATCGAACATACACTTACGAT
TATGGATCGCAGATCCCGGTTCAGACGTTCACAGAACGACACCCAGCGAGCATCTTGCCTTACGGACGTGGATCACCGGC
GATAATGTTCCTCAAAAAAGCTCCGTTTGTCAGCTGTGTTCGCCAACTCTTAGCCGCGGCCCTCATCTATGACAGCAGTG
ACGGTGAGGAGCTTACCATCGACAACGAAGAACGACACGAACCTGCTTGGCAACAGGCCTACCTACGCATTGGCGGTATA
CGGTACGCCCAAGCCTTGTCCATAAGACCTCTGCAATACATGTCTATGGCGGAATCGGCATTTACGCATACAGCGTGGGC
TCATGCACCTGACGAGTTTTTGCTGTCAAATTATGTTCAAACCTTTTCTGCACATATTCAAAGTATATGCCCAATCATCG
CAATCGGAAATCTAGAAGGTGTCGTATCGGAATTTCTCCGACACTCCAACACTCTAGAGCATCAGGAAAGACAAAGAGCA
TCGGACTTGTTACATGTCCAAGTAGAGTATGCCATTGAAATGCTCGTCTTTGCCCTTGGCAGCGTCTGCTGGGCAAAATG
TGGTGGACCAATAATCGAGCCTGGCCCCGAATTCTATGCTCGTGCCAAGGGCATCCTCGAGCTATTTGCAGACGAAAACC
GAGTCAAAACGGCGGTTGGGAGCTTCGAAAACCTCAACAACAATGGAGAATACAATTTCGAACGATATTCAGCATACACA
AACGAAACGACAATTGACTTGGCTCGTGCCCACCTTCTAGCCGCCCTCTTCTGTGGGCAGTTAGCTTGGGTTTTCGAGGC
AGCCCAACACGTCCGCGATGCCAGTTCGGCCATTATGTATTTGATACATCAGCCCAGCAGCGGCTCTTTCAGTGACATGG
CGCAGGACACTCGCGGGCCATCGCTCGTCGAGTATGCCTTTCATCCACATACGCTTTCGCACGAAGAACGCCAACTGGTG
TTGCTGTATTGGATATGTGTTTTCCTGGAATTGTGAGTGCCATTCGCTTGCAGCAAGGATATGCCAGACTACTGACACGT
GCTTGTGAACAAAAGCGAGATCAACGCTGAAGTCTGTACACAACCATCACCCTTGCTGCACTATCAATCAACAATTCCCC
CACCGATTTTTGACGAGAGCCCGATCGAAACTGCCATGCGTAATGACGAGGACACGGCGATGACCGACGCCGATCCGAGC
CGGAGTATCAACAGTGGCATTGCCGGCAGAGATATGAAACAAGAACGGGATGTGCGAACTAACTTTGAAGCACAGGTGTG
TCTCCGCAGTCATCTCAACCGCATATACGTCGAAACATTTTGCGGGCAGACTGAAGCGAGATCCGCCGTCGAGGAGCTTC
AGCTGCAGTTTCAAGGCCTCTCGATATCACAGCCTCAGCCGTCTTCCGTCTGGAAGAGCACACTCACAGCCCGAGCCCGT
GCCGGCTATTGGGAGGGTGTCGCCTGGGGGTTTCTGCCTGTGCTCGAACAAGCCTACGAACAAGCCGACCCAGCCGATCT
CACGGCCGGGGTGTGCAGTCTGGCAGAAGTCATCCGAGCATACCATGGCGTGGCAGAAGGCCGGCTCATCCTCCCCAATT
CCTTTGGAGCAGCCATGATGTACGTCGGCCAGTATATCCTGCCCAGCACAGCTCGCAAGCTAATTGACAGGCAATGCCGA
TACCTGTTGCTGCTATTTGCCGCATCACGTGCCATGCCAACTGTGGCAGAAATCGCTACCGACGCTATGCTAGGAGAGCT
CATTGAAGGCACCGCAATCTCGTTGCAAGAAATGGCTGGCCCGCCAGGTGTGTTGCAGTCGGCTAGGCGTGTGCTCAGAG
TGATGCAGCAACAATTGCAGGCCGGTGCAAAGCCAGCTCCTATGATCGACGAGGCAGATTCGGTCGCGGTCGCGGTTGCA
GACGTTCCAGAAGGGCAAGTCTATGTCCCGGGCCTGTCTCTGTTCTGCCCTCCGTTCTCGTTCTTCGCCGACTCAGGAGG
TGCTTTAGCAACTGCTACAACCTCCGCGTCGTTCACCTCGCTTCCGACGCCCAACACAGCAAGTTGTTGGTCCTCCGGAA
CATCCCCAATCCCGCACACCCTCTCGTCGCCGCTTGGCTCCCCGAACTCTTCTCTGGCGTCACCGCTAGCTTCCTCCGTT
CCAGCTGTCAGTTCTTATACCCTGGGAGCGAAAGGAAGTCTCGGACCGTCCCCTTGGCTTCCAACCTCCGCCGTCCATCC
TTTGTGGCAGCTGCCAGGTGCCGTTCAGACTGTGTCTGAGCCGTCTTTCTGTTTTGCCGACATTCTTGCGTTTTCCTACC
AGCTGGGCCTTTCTCACCCGTTCGATTCGCCAGGAGAACTGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62