GenePrediction:GLEAN_4219 Details

Name: GLEAN_4219
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:147302..145194 (- strand)
Length: 2109
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:147302..147056 (- strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_160:146568..146262 (- strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_160:146114..145789 (- strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_160:145732..145194 (- strand)
Length: 539
>GLEAN_4219 class=GenePrediction position=GCSC_160:147302..145194 (- strand)
ATGGCTGGGAGGGGAAAGCCATTTTTTTCTGCTTTCTTTTCAGGTCTCATCAGGAGAGGAGGCTGGGAGCTGATGGTCCA
GGGCGGGTCCACTAAGCAGTTTTCGGCGGACAATAATCAACAGAGCAGAACAAGACCGACACGGAGACGCACCACAACGG
CACCACACGCCGTAGCCGTGGCTGGGGAGGGGGCAGGAAGCTCCACCCAGTCTGCATGGGATACGAGTAAACAGGACCTC
CTCGTCCGTACGACGTAGACGAGACCGGGCCCAGACGATGATCGCGGTTCCGTAAGCTCCCATACGCCTGAGCGGAGGTA
CTCGTGCCGAAGTACTTCGTATCTCCCTCACAGTTGCTAGGGGGGGTGTGTGCAGTGTGGTCCTTTGTTTTGTTGTCCTG
CAGGCTAGCGGGTAGTGTTTCTCTCGCCTTCTCTCTTTCTCGCTCGCAGAGTGTGTTGCCGTATCCTCGCTGCTCTCTGT
GGCTGGCCAACCACGCGCAGGGTCCAGGTGGCCTCCCCCATCCTGCCCCCTATTTTATCCCGGCCGGTCCTTCTCTCTGG
CTATTTCAATCCTTCCTTTCTTTCTCTTCTCTCCATACCACTCCATCAGATCACAGCTTTCCATTCCACAATTCATTTCC
TCCAAGCCCACGGGTATCCTCTTCTCCTTTCTCCTTTGAAAGAGCGCCACACGGGAAAAAAGTCTCCGAGCTTTTTTTCC
ATCCGCGCTGCTAGAGGCCGTCACCCTGGATTTTGAAGCCAGAGTCCCGGTTCCCTTCAGCATCTTCCCGTCTTCCTACA
AGGGAGACAAGACCAACCAGGCTTCTGCCACCACTGAGGTCCAGACCCACGAGGAAGTCAGCTTCCATCTCCCCACTACC
GAACGGCCCGGACGGGAAGGTCAGCTCTCTTCTTTTGTCGACGAGTCCAGCAGCCGCTACACCGAGCGTGTTTCTGAGCC
CAAGTACGAGGAAGAAGAGGTCCGCGTTACTCGTGAAGAGGAGCATTACCACCGTCCTGGTGTCCGCCGTCGTGAAGACC
GGTAAGCCCTGACATGCCAGCAAAGCCCCATCTTCTCCTGCCTCGGGACGGTCCGTGCATTCCAATGCGGACCCACTGCC
CACTGCATATATATATACCGGAGCTCAGCCCGCCTTCATTCCTGACTGGCTCGCTAACTCACTCTCAGCCATCGCAAGAC
TTTCTCCGACACTACAGTAGCCGTTCGTCGCGACCTGTACACGTCTCCCATCGACGCAGCTGAACGCCAATACCGTTCTC
GCTACCAGCCCAACTACAACGAAGACGTTCGTTCGCACACCAACCCTGCTGCCGAGTTCGAACACTCCGGTCGCACCCAC
AGTCCTCGTCGCTCCCACGCCGTCGAGACCGTCACCACAGTAGACACTCCCATCCGGACGTCTGCTTCTCACACCGAGCT
CGCTCTCACCAAGTTCGTCGATACCAAGGTCGTCAAACCGAAAACCGCCAAGATGGGCTACTACGATGAAGACAGTAAGT
CGCGAAAACGCAGACCCACCACAACGCCACTCTGCTAACTTTGCCACCAGCTGAGCACCAGAAGCTCGAGGTTGCCGAGA
TGCGGTCGTCCTCTGTTGGCGCTCGCCGCAGTCCCTCCCCCGTTGAGGGTGGCGGTGCTCTGCCGCCCAACACGGTGACC
ATCCCGTGCCACCACATCCGCATTGGTGACATCCTGATGCTCCAGGGCCGCCCGTGTCAGGTGATCCGCATCTCCACCTC
GGCTGCCACTGGCCAGCACCGTTACCTCGGTGTGGACCTGTTCACCAAGAAGCTGCACGAGGAGTCCTCGTTTGTCACGA
GCCCGGCCCCGAGCGTCGTCGTTCAGACCATGCTCGGCCCTATCCTGAAGCAATACCGCGTCCTGGACCTGCAGGACGGC
AACGTCGTCGCCATGACCGAGACCGGCGATGTCAAGCAGGACCTGCCCGTCATTGACCAGTCCAACCTCTGGACTCGCCT
GACCCGCGCTTTCGAGTCTGGCCGCGGCTCTGTCCGCGTCCTGGTCGTCAGCGACCACGGCCGCGAGCTCTGCGTCGACC
TCAAGGTTGTGCACGGTGTCAGCCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62