GenePrediction:GLEAN_4221 Details

Name: GLEAN_4221
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:139968..136811 (- strand)
Length: 3158
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:139968..139925 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_160:139504..137124 (- strand)
Length: 2381
Type: CDS
Source: GLEAN
Position: GCSC_160:137052..136811 (- strand)
Length: 242
>GLEAN_4221 class=GenePrediction position=GCSC_160:139968..136811 (- strand)
ATGCTCTCCCCCGCCACCTCTTCCCAGCCTCCCCAATTCTTCAAGTTCTTTTTTTTGCTAATGACGCCAGGACGTTGCCA
TAACTCTCCTTTATTCTTGCTTGCAGCCTCCTCTCCAAAGTCGCCTGGCCTGCTTACCTCTCCAATTGACTATTTCATTA
CTCCGTACTATTCCTCTACTTTGCACGTTTTGTATCTCACCGTCCACGAATCTGGTGAGTGTTGCCCCGTTCATCCACCT
ACTCTTCCTATCCACACTTCTGTTATCTGCTCGTATCCACCGTGCCTCACCGTCTGCTGCCCGTCCCTCTCTGCTTCGTT
TTGTGCAAGCTGCTCTGGCACGTCCAGCAGAGAGTGGAATGACTAGGAGACTAGCACCCAGCGCCGAGCTTCTTGACTAG
CACATTCTTTGCGCGACCTCGACCCTTGAAGTCTCAGGATATTCTAACCAAGGTCCAGATTTAGTTCAGAGCCTGTTTTG
CACCGTTTGACAACAACTTCGATACCTCTCTTTCGCGGGAGCTTCGCTCGCAACCCCTTTCTCTTCAGCTGCCGCAGCAC
GCTCTGCGGGTTTCCCGGCGCCTTGTCTGCTCAAGCACCAGCCTCGTCTGGTGTTGGGTACTCAATATCTGACACGTTGA
CTGACCCCATCCCCGTTTCTTCTCACGACCGTTACGACCATTACGAATCACCGCCCTTCTCCGGACGGCGTCCCAGCACC
CCCCTACCTTCCGAATCAAGAAGCGCCAGTTCCAATCTCTCAACACGCTCTTCGCAGCGTGTTCTTCGCCGGACATCGCG
CTTTAGCGCCAGTCCTTCCCCCAAGGCTGTCGATCAAGCCTCAACCTCCTCCTCGCAAAGGCGTGTTCATCTTGCCGCCG
TCTCAACTGGTATAAGTCCACGATTTGCGCAAGCTACAGAGGAGGAGCCGGTGTTACAGACTCGAAATCGTTCTCCACCC
CGCCCGCCTTCGCAGGTTCTTAGCGACGACCAGGACGAGGAGGCCCGAGAGGACGACCAGTCGTCTGTCGCTCATCATTC
GTCCCCGCACGCATCCGCATTTGGACCTTCCATCTTACTACGCGATCAGTCGGCCATCCATCCAGCTGTCCGTATCTCAA
AACGGACCCATAACGCAATTCTTTTTGCCGCCGAGGCCCTGACGCATCCCAATAAGCTTTCTCCTGACTACGAAGAAGAG
CAAGCTATGATGGCGGATCTTCTTGTAGAGGGGGGGGCTGGAGACCCCGGCTCCATTGGCAACGGAATATCATCTGCTAG
ACCGCAAATACCCCCAGCACAGACGAATTCTCCGCGCAGCAATATCCGTGGCCCAAGAATGATCATGCAAGAGCGGCAGG
AGCGTGAGGCACGACGTGCCGAGCAGGAGAGATTACAGAGGGCGCAAGCTGAACAAGATGCCCGTGTACTTGCCGAGCAG
AGGCGACAGGTTTCGGAACGAGAGCGTGCGACGGCAGCGGCGGCTACTGCTGCTCCTGAGACCACGACGGCCGGCGCACC
TCAGCCGGTCGATCTGGCCACTCAACGAAGACAAATGCGAGCACGCGCCGCTAGCGGACAAGGTGGTGCGGCCCAAGCGG
TACCACCTCCATCACAGCCACCAACAGCACCTCAACAGACACAGCCACAACAAAGACCGATCCGTCTTCCACAGACATCT
CAAGCTCCACCCCCAATAACGAATCCAACCATCCCCCCCGCTTCACAGGCGGTACCGAGTGGCGGACTGCCGCCAACTGC
AGGACTGGCTGGGGGTGGCACAGGCGCGGGCGCTGCGCCCCAGGAAGGAGAAGCTACAGGCGGTGGTGCTGCTGGCGGAA
GCCGTCCTAGAAACTCATTTCCGCACGCCTTTGAGCGATGGGAGGCTTTGTCTGCCCATTGGGAAGGCCTGACCAGTTTC
TGGATCCGCCAGCTACAGCAGCGGTCCGAGGAAATTGACCAAGATCCATTGTCCCGGCAGCTTGCACGCCAGGTGACGGA
CCTGTCGGCGGCAGGTGCCAACCTCTTCCATGCAGTTGTCGAGCTGCAACGGCTGCGCGCTAGCTCAGAGCGCAAGTTTC
AGCGCTGGTTCTTCGAAATGCGAGGAGAGATGGAACGGAACACCGAACGCCAAGGGATGCTGGAGGCTGCTCTCCAGGAA
GAGCGGCGCGGCCGTGCCGAAGCTATCCGGGAAGCCGTCGAGAATGAACGTTCCAACTCCAAGATACAACGGCAGCTGGC
TGAAATGCGCAAGGAGCTCACGATTTCCAAAGAAGAAGCCAGACGTGCGTGGGAAGAGCTTGGCCGCCAGGAGCAGGAAG
AGCGCGACCGCGTGACAGCGTTGCAAGAAGGACTGCCCACGACTGTGGGTGGGGTGCAGGTCGTGCCCATGGCCCACGGC
GTGCCGGGTCGGCGTCGTGCTAGTAGCAGCGCAACCAGTCACGAGCCTCAAGTAGCAGCCCAGCCTGCGCAGAGCACGCA
TCAATCACCACCACGGGCGCAACAGCAACAGCCGCAACAGCCACAACAGGCGCAGCAGCCGCAGCAGTCGCAACAGGTGC
AGCAGGCACAGTTGGCACAGCAGGCACATCAAGCACAACAGACACAATTGGCACTCCAAGCCCAAGCGGCACACCAAGCA
CGACAGGCTGAGCAGGCACGGCAGGCTGAGCAGGCACGGCAGGCTGAACAGGCATCGCCAGCAACGTCGGCAGTGGAGCT
GCTGCCCTCGCAGCAGCACCCAACGCATTATCCGGCGCATGCAGCAACCGGCGGTGATTATGCTGAACAGGGAGCAGAGG
GTGTCGGTGCAAGTCCGAGATTTGAGGCGTCGTATAGCGAAGGAGGTGAGTCTGAATAGAAAGATCGCGCTTTGTGCTGG
CCGGGCTTCTACGAGAGACTGACCTTGTGCTTGCAGAGGAAGAAGCTCAGTACGGAACTCCATCATCTCTGCCACCGTCA
ACTACCTATCCGCCGTCGAGCAAGCATTATTATGCGCCGCAGGCGCCACAGGTACCGGCAGACTACTCGGGGCAAGGACA
CGGTACTCCGACTTGGGATACGGTTCCACGCCATCACCACCCAACACGCCTGAGTGACGTGATCGAAGAAGACGACGAGC
GCAGCCGCACATCGGCTAGCCAACTCAGCCGCGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62