GenePrediction:GLEAN_4223 Details

Name: GLEAN_4223
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:131928..129512 (- strand)
Length: 2417
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:131928..131739 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_160:131681..130148 (- strand)
Length: 1534
Type: CDS
Source: GLEAN
Position: GCSC_160:130094..129512 (- strand)
Length: 583
>GLEAN_4223 class=GenePrediction position=GCSC_160:131928..129512 (- strand)
ATGCTTCGTCCGGCCACACCACTAGCCGTGGTGCTCTTTCTTGCCTTCGCCCTCCTCATCCTCTCCGTACTATCCACCCC
GATCATCAAGGTCATCCCTCTCGGCTCCTATGAGGGTATCAATTTTGGAGTCTTCGGCTTCTGCCTGGCCGATGGCTCTT
GTTCCGGCGTCGAGCTGGGCTACGATCCGGGTATGTGTTCTTGCTTTTCTTGCGTGCTTTGTGCATCGCATGGCTAACTC
TCCCCAGCATCGCTCTACTCCTCCAGCGCCTCGGCAACCTTTGATCTGCCCGCCTCTACGCGCCACACCCTCTCTACCAT
CCTCATACTGCATCCTGTTGCCGCTTTCCTGTGCCTCGTCATGCTTGTTCTGGCCTTTGTCGCCCACTTCCATTCTCCTG
CTCATTCTGTTCGCTATCTCCTCGGTGTCTTCATTGTCAGCATATTTGCCTTCCTGGCCGCCCTGCTCGCCTTCCTAATC
GACATCCTCTTGTTCGTCCCCCACATGGCATGGGGCTCTTACATCACCCTCGCTGCCGCCTGTCTCATCGGCCTGGGCAG
TATCGTTGCCTGTGCCATGCGCCGCACTCTCGTCAGCCGCAAGACCCGCAAGCACCGCATCGAGGCCAATGCCGAGATGA
GTGGTGAGAACTTTTACAATCGCCAAGCCCAGGAAGTCGTCACCACCGTTGTCAGTGGCGGCGTCGCCGACGGCTCAGAG
GCCGGCGTTGCGCGCCAGCCCACCGTCCCTCAGATCGACCAGAAGGAGGCCACGAGCAGCGAGGAACAGATACCCCTCAC
TGCACAGACATCTTTGCCTGGAGACTCCTACTCGCAGCCCCTCATTTCGCAAAACCAGTATCAGTATGGCGTCCGCAGCG
GTTCGGTCGAGCCTGCTGCAATGTCAGGCGCTTCAACCGGGCCGCCTCGCCTTACCGACCGTTCTCAATCCACTCAGCGA
GATGCGTATGGAAACGTCCCACCTTACGGTAATGCTCCCCCTCTAGACAGCTACGGCGCACGGAGAGGTCCTGTCCCAGA
TGCTATGGGCAACATGCCGCCCTCGCAGCGTGGACGGGGAGGCGGACCCGGTTATCGTGGCGGTCGTGGAGGCGGGCCAG
GGCCGTATGCCCAACCCGGTCGTGGGGGCTATGGTCCGGCACCTGGTAGAGGCGCATATGGCCCGCCTCCGGGGAGAGGT
GGCTATGGTTCGCCTCCAGGACGAGGCGGTTATGGACCACCAGGACGAGCTGGCTACGGGGGTCCCATGCCGCCGTATAA
CGGACGAGGCAGAGGTGGCTTTGGTGGCTATGGACCTCCACCTGGCCGAGGAGGCTATCCTGGCCCCGGTCCAGGCCGGG
GAGGCAGATCGCCACCACCAGGCTACCAATACGAAAGCACCGGCTCCTATGGCAACAACGGACAATCTACTGGCCCACAA
GTCGGCTACTATGCGAATGCGGCTGTGCCCAACGCGAGCAACGGTGCAGACGGCAACAGTGGTGCCGCTGCTGTCAACGG
GCAGTACAGCCACGACCGATCACCATCTGCCGACCTGCCAAGAGCCGAGTCTCCTCCGCCCCTTCCGAACGACCCGGTCT
TTGAAGCCCCTAGCCACGCAGTCGAGATGGATGCATCTGTTCTGCCCTCCCAGCCCCATCAACTGTCACAGCAACAGGCG
GGCCGTTTTAGCGACGGTGATTCTGAGATTGCCGGCTTGGTTGGCCTGCAGGAAGGACGAACCTCGCGGGGCTTGCCGGA
ACAGCAGGCAGAAGCAGCCGAGTAAGTCGCCTTGCGCTTTTCCCTGCCAATTGGGCTCCCACTAACATCTGCAGTCAATA
TGTGCCTCCACGAGCACACTGGAACACAGAAGGAGCTGCACCCTCCGACTTGCAGGGAAGCCGCGGCCTTCCGCCGGCCA
CAGAGGCTACCGAGCAACGGCCCTCGACGTCCGAATCGTATGTGGAAGATATCGACCCGCGCTTTGCCGAACCGCAACGC
AGCCGGCAGCAGCTGCACGAACCCGCAGCGCCACAGGTGATGGCGAACCACTCTTATGAGGATATCCCAGAGGGCGCGCG
AAGCCCAGCCGAGTCTGAGCGGTCAACATTTACGTCCATCTCCCAGCGGGGCATCAATCCACGTTGGATCCCGCCACCGA
GTATGATGCCTGCATATGGTGCTGGTCCCGGCGGTGTGCCTGGCCCATACGGTCCGCCTGGTCACATGATTTCTCGCCGT
CCATTACGGGACCCCAACGAGATCCTTCTCAACACCAACCCTGACTTCTCCCTCCCAATAGCTGCTGGACGTCAGCTAAC
AGGCGGCCCTCGAGGCGGCCCCAGTAATGTGGGTGCTGCCCGTAGCGGCCCCGGTGGCAATAGCATGATTCCCGGCAGCG
CCTATCCAGCCATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62