GenePrediction:GLEAN_4224 Details

Name: GLEAN_4224
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:123800..120592 (- strand)
Length: 3209
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:123800..123725 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_160:123614..123304 (- strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_160:123223..121909 (- strand)
Length: 1315
Type: CDS
Source: GLEAN
Position: GCSC_160:121852..121031 (- strand)
Length: 822
Type: CDS
Source: GLEAN
Position: GCSC_160:120827..120592 (- strand)
Length: 236
>GLEAN_4224 class=GenePrediction position=GCSC_160:123800..120592 (- strand)
ATGGAATACGGCAAAAGGGATGAGGATGCCGATGGCAGCCTTGTCCGGGTCGACCGCACGCAGGTATTCCAAGAAGGTGT
GTATCTCATTAATGGGCAGACGTTAGCCCCATCGACGACGTGCAGCATCCAGTGCTTCTGCGGCGCTTTCCTGCGTCGGT
GATGAGCACAAGCTGACTGTGTGCAGCTCGATTGTTTAACAGCTCTCCCATCCAGCCGAGACAATGCCGCATTCTCCTCA
CCAAGATCGCGCTCCTCCTCTACACAGGGGAGAAGTTTCCGACCAACGAGGCCACGACACTCTTCTTCGGCATCTCCAAG
CTCTTCCAGAATAAAGATGCCAGCCTGCGCCAGACGGTCCACCTGGTGATCAAGGAGCTGGCCCACTCTGCCGAGGATAT
CATCATGGTCACTAGCACAATCATGAAGGACACCGGTGGCAGCGGCGATTTCATCTACCGGCCCAATGCCATCCGAGCAT
TATGCCGGATCATCGATGTATGCCAGACCCTGCTGACCGGCAACGCGATTCTGGTAGACTCGAGGACCTTGCTGACGTGT
GCTGCTTGTTTCGTTAGGCTACGACTGTGCAATCCATCGAGCGCGTGATGAAGACGGCCATTGTTGACAGAAACCCGTCC
GTATCGTCGGCCTCTCTTGTTTCTTCCTACCACCTGCTTCCCATCGCGCGCGACGTCGTTCGGCGCTGGCAGAGTGAGAC
GCAGGAGGCTGCGGCGAACACCAAGTCCTCTGGCGGGTTCTCTCTCGGATTCTCGTCGAGCTCGGGCTCAGTGCCCGTCA
ACAGCTCGACCATGACCCAGTACCACGCCATCGGGCTGCTCTACCAGATGCGGATGCACGACAAGATGGCCCTGGTCAAG
ATGGTGAAGCAGTTTGGGACAGCAGGTGCGGTCAAGAGCCCTACGGCAGTCTTGCTGCTCGTACGTCTGGCGGCTCAGCT
GGCCGAGGAGGACCCGACGCTGCGGCCGTCGATGGTGCAGCTGCTGGACGGCTGGCTGCGCCACAAGAGCGAGATGGTCA
ACTTCGAGGCGGCCAAGGCGATCTGCGATCTGCGCGACGTGACGGATGCAGAGGTGTCGCAGGCGGTGCATGTGCTGCAG
CTCTTCCTGACGTCGCCTCGGTCGGTGACCAAGTTTGCGGCGCTGCGTATCCTGCACAACTTTGCGTCGTTCAAGCCGGA
GGCCGTGCGGGTGTGCAATCCAGACATCGAGCTGCTGATCTCCAACAGCAACCGGTCGATTGCCACGTTCGCCATCACGA
CGCTGCTCAAGACGGGCAACGAGGCCAGCGTCGACCGCCTGATGAAGCAGATCAGCGGGTTCATGTCGGAGATCACAGAC
GAGTTCAAGATCACCATTGTCGAGGCCATCCGCACGCTCTGCCTCAAGTTCCCCAGCAAGCAGGCCGGCATGCTGGCCTT
CCTCAGCGGCATCCTGCGGGACGAGGGCGGGTACGAGTTCAAGCGCACCGTCGTGGAGAGCATGTTCGACCTGATCAAGT
TCGTGCCCGACTCGAAGGAGGATGCACTGGCCCACCTCTGCGAGTTCATCGAGGACTGCGAGTTCACCAAGCTAGCCGTG
CGCATCCTGCACCTACTGGGCATCGAAGGCCCCAAGACGTCGCAGCCGACAAAGTACATCCGCTACATCTACAACCGCGT
GGTGCTGGAGAACGCGATTGTGCGCGCGGCGGCGGTGACAGCCCTGGCCAAGTTTGGCGTGGGCCAGAAGGACCCGGAGG
TCAAGAAGAGCGTGCAGGTGCTGCTGTCGCGTTGCCTGGACGATGTGGACGACGAGGTGCGCGACCGTGCGGCGCTGAAC
CTGCGGCTAATGAACGAGCCGGATGCCCTGGCAGAGCGCTTTGTCAAGAACGGTATGTCGGACAGTCTTTGGGACTTGGC
TTTGCAAAAGACTAACAAAGTGGCGCAGAAAACATGTACTCGCTGTCATTCTTTGAACACCAGCTGGTGACATACGTGAC
GTCGGACGAGAAGGACACGTTCACGACATCGTTTGACATCTCCAAGATCCCGGTCGTTACGCGCGAGCAGGCGGACGCGG
AGGACCGGACGAAGAAGCTGACTGCGACGGCGCCAACGCTCAAGGCGCCCAAGGTGGGAGGCGCAGCCAAGTCGGCGGCG
TCGGTTGCAGAAGAGGCAGCGTCGGCGTCGGCGCAGGCGCAGAAGTACGCGCAGGAGCTGCTGCAGATCCCGGAGATCCA
GGAGTTCGGGGCCGTTCTCAAATCGTCACCAGTGGTAGAGCTGACTGAGGCCGAGACGGAATATGTGGTGAGCGTGATCA
AGCACATCTTCAAGGAGTACATTGTGCTGCAGTACGAGATCAAGAACACGTTGCCAGACACGGTGCTGGAGAACGTGTCG
GTGGTGGCGACACCGTCGGAGGAGGACGAGCTGGAGGAAGCCTTCATCCTGCAGGCGGAACGTCTGGCCACCAACGAACC
AGGCAAGGTGTATGTGGCCTTCAAGAAGGTGGCCGGGGCCGATGGACTGCCGACGAGCACCTTTTCCAACGTGCTCAAGT
TCACGAGCAAGGAGATCGACCCGTCGACACGCGAGCCGGAGGAGTCGGGCTACGACGACGAGTACGAGGTGTCGGAGTTC
GACCTATCAGGCAGCGACTACGTCATCCCGACTTTTGCCAGCAACTTCAGCCACCTTTGGGAGCAAGTGGGCGCATCGGG
CGAGGAGTCGGAGGAGACGCTGCAGCTCAGCGGAGTGAAGAGCATAGCAGGTGTGTATTGGTTCTCGGGATGCTCTCATT
TTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTCCTTCTTTCCTT
TCTTCTCCTATCTTTCCCTTTCTTCTCCTTTCTTTTCCCTTTCTCTCTTCCTTCTTCCAATATACTCTCATACATCTACT
AATTCTGTCACAGAGGCGACGGACCTGCTGGCCAAAACACTGTCGCTGCAGCCGTTGGAAGGCACAGACATCCCCCAGAG
CCAGACGACCCACACGCTGAAGCTGTTGGGCAAGACGGTGGGCGGTGGTCGGGTGGTGGCCACGGTGCGGATGGCGTACT
CGACCAAGACGGGCGTGACGACCAAGGTGACGGTTCGCAGCGAGGAGGAGGGCGTGTCGGCGCTCGTGGTGGCCGCTTTG
GACGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62