GenePrediction:GLEAN_4225 Details

Name: GLEAN_4225
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:108318..99602 (- strand)
Length: 8717
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:108318..108247 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_160:106667..106394 (- strand)
Length: 274
Type: CDS
Source: GLEAN
Position: GCSC_160:106325..105012 (- strand)
Length: 1314
Type: CDS
Source: GLEAN
Position: GCSC_160:104109..103360 (- strand)
Length: 750
Type: CDS
Source: GLEAN
Position: GCSC_160:103297..103150 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_160:103079..103073 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_160:103021..102923 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_160:102847..99602 (- strand)
Length: 3246
>GLEAN_4225 class=GenePrediction position=GCSC_160:108318..99602 (- strand)
ATGGTTCCTGCAGCCTGCGGCCTTCTGGACGACAGCGAGGCGCGTGCTGAGGCGCGGTCGTGGCAGCACACTGTGGGACT
GCTGTCCAGCGATCCCATCTTGGACTCGGCAATCTAGCGGCAGGGCCATTCCCGACGCTTGGCAGGCACCGGCGTCTCAG
TGAGCGTTTGCAGAGAGGATTGCGTCTTGTTTCCAAACTGTCCTTTTGAGGTCTGTGGGATGAGGTGGGAATTACAGGGA
CCGTCTGTTTCAAGGTTCGTCCCATGCAACGCTTTTGCGCCAGGGATAGCCATTAGCGTCTATGGGTACCTGGTACTTCT
GGTGATAGCCGCTCCAGCGGCTATCTTAGCACCCGTTGGTGTTTCTCCTGTTCAGTCGGCAGGCAGCAAACGGGAAAGTA
CCTGGAGGGTGGCAAAGGGCGCAAACCCGCCAACGCAAGTGCTTTTAGGGTTGCACCATCTCTCTGGGATGGTCCGATGC
AGACGCAGGCGCGGCCGTGTGTCGTTGCATGTTGATCACCTGCTACGGACAGCTTTGCTGAGCGATGGACTTGAGCCGGC
CGGCAGTACAGAGGCTACATCGACAGGGCCACAACTCGCCGTCTGGCCATCGTCGCCTCCCACACCGCCCTTGTCAACTT
TGGGCCTGAGGGGGTGTGGGAGGAGGGGGTGAGCAGAAGGTCCCGAGTTCCAGTTTTCGACCCCGACTAGCCCCTCTTTC
CCCCTGCAAATACCCCTGTCAACTCTGCGGCCTGTGATTGGGCAATGGCCTTTGCGTGTGTTCTCCAACATCGGCCAACC
GCCAGTTTCCCACCCCTCCTCCCCCCTATTCCTCGACTGAGCAGCAACCTTGTTCCCTGCTCGTCCCCTTCATCTCCAAG
ATTTCATGCTGCCCTCACACCTCACACACCTCACACACCTCTTGCTGTCCTTCTTCACTACTGCCGCCACTATCCTGCAC
TGCCGTTATTATCCACCCGGAAAAAGCATCCAAGCAGCCGTACGCTGGAAAAGGAGCGCGGCCAGAGGACCAGCCCATAT
CGGACACCCACGTCGTTCACACTCTCCTTCAGGCCTGGTCTACTTAAGAACCCTGCCCTCCTCCTTCCGCCTTCCACCCC
CACAAAACTGTTGTACAGTACCTCGAACTTCCTTTCCGTCTTATTTGCTCTTTTATCTTGCTCTTATATTGCCTCGCCGT
ATTTTGGCAACATACCGCCTACCTGTTTTGAACTGGCCGGGTTAGTGTTAGTGGTCTCGCACCTCCTCTATCTGTTCACC
GCCGACGATTGAACCCTTGGCTCTGGGTCGTGATATCTCGCATGCCTTCCTCGCGTCTACCTTCAGTGAAGGCGACAATA
CTTGCCTGAGCAGGGCTTAATGCTGCTAGGCAGTGCCTTGTGCAGTCCGGCTCGGCGGAAGATGATCAAACCAGCCCCTA
CCCCCTAGGCCATCTCCTTGCTGCAACCAAGACCCTGGTGATGGCGATTTTAATCTCGAGCCGCCACATATCCCTGAACA
GCTGGCTAGAACGGTTTCGTCGCCATGCTAGAACCCTCTGACCCACACTTGTCGCTTCGTCTCCTGCACTCTATTATAAC
GCACCTATACGCATCAGGACATTTTAGCTGACTCGGATGCTCTGTATATAGCAACATAACCGCCACGCACAACAACATCC
GCCAGGCCACGCACAACACTTACAGCAACAACCCCAAGCGCGGCCTCCGAGCATAGTGCACCAGCAACACCACCCCCATC
ACTCGCAAACGCCACCGCAACAGCAGCAGCACCAGGCGCCATACGCCCCCGTGTATCAGCAGCAGCCACAGCCAAGCAGT
GGCCAGCAGCACGCACAGGACATCTACAACTACCAATCCAGCCCGTACAACGCGCCCGCTCCGACAGGCGGGTATACCTC
TGCAGGTGAGTGACGTGACCGGTGTGGGAGCGCAGAGCGGCCACGAGCAGATCGCTGACTGTTGCGCGCGCAGAGATGAT
GGCCGCCACGATGTCCAGGCCTACCTATCCGCCCATGTCGTCGTACCACACGCCGCAGTCGAACTCGCCCGCGTCGGTGG
GATCGACCGGCGGCCACGACCAGCAGCGGAGCATGTACGGCCAGCCACCGCCGCAGCTTCACCAGCAGTCGATGTACTAC
GGACAGCAGCAGTACCAGCCGCTGCCGCCGGCGTCTGCTTCTCCGTACGGCCAGCACGGGCCGCCGCCACACCAGCCGAT
GGGCTCGCAGCCGAGTATGATGATGTCCCACGGCGCGCCGTCGCCAGTACAGCACCAGATGGCACAGCATGCGAGCCAGC
ACAGCCCGGCGTCGGCCATGGCCGGCAGTCCGCGTCACGCGAAGATGGAGGTGCAGAGCCTGACGCCGCAGCTCTCGCGC
CAGGCACCGCCGGCAGCACCATCACCGCTATCGATGGGCCAGGTGCAGGCCGCCCAGAGCATGCAGGCCCAAGGGATGCA
AGCACACCAGCAGCAAGGCATGCAAGCCCAGCAGAGCCTGCCGCAACACCCACAACACCCACAGCACCAGCAGCATCCTC
AGCATCCCCAACACCCACAACATCCTCAGCATCCCCAGCACCAGCAGCACCCACAGCACCCGCAACATCCGCAACACGCC
CAGCACCCACAGCATCCGCAACACCCGCAGTCCAACGGGGCCAGCCCGCTGCCCCAGGCCGGTGGTGCAGGCAGCTCGGT
GGTCAACCCAAACGCAGCGCCGGGGCCGATTCCAGCAACGACGCCGTTGGTAGTGCGGCAAGACCAAAATGGAGTGCAGT
GGATCGCGTTTGAGTACTCGCGCGACCGGGTCAAGATGGAGTACACGATTCGGTGTGACGTCGAGTCGGTGTCGACGGAG
GAGCTGTCGTCCGAGTTCAAGCAGGAGAACTGTGTGTACCCGCGGGCATGCTGTCCGCGGGAGCAGTACCGGGGCAACCG
GCTACAGTATGAGAGCGAGTGCAACACGGTAGGCTGGGCGCTGGCACAGCTGAATCCACCGCTGCGCGGCAAGCGAGGCC
TGATCCAGCGGGCCGTCGACAGCTGGCGGAACAGCAACCAAGATCCGCGACTGCGCAGCCGTCGGGTGCGGCGGATGGCC
AAGATGGGCACACGCAAGGCCGTCAGCGCCGGCACAACCGCCCCGGGACTTGCACAGTCGCCGGCGCATCTCGGTGGCGT
GGCCACGCTGTCCGGGGCGGCCACGCCGCTCACGAAGCCTATGCCGGGCTTGCCTCCGCAGCTTCATCACCACGACGGAA
GTGCCCATGCGGGCGGTGACGAAGTCGGTATGTTTCACCAGATGTGATTGCCTCTGTCCGTTGTCTGCGTCTGCACCTGT
TCTGTTCTCTTCTGGAAACCCGTTTACCCCTTCTCGTTTATGACAACCTAGCACGACGCTTTTGATACCTGTTGCAAGAC
TGCCATATATATATGTGCGCATTTCTCAATATTTTGCTTTGGAACGCTCCCTTATTCTCTCTTCCTCTTTTCTTTCGGCA
AGGTTCGGGTTGTCATTTTGGCTCTACTTGGTTCAGGCTTCACAAAAGGACGTTCTGCGTCCTTTTCTCTGCGTGTTTGA
TATATACTCTCCATAGGCGCTTGTCTCCTTCCCGGCCCCCCAAAAGTTGCTCAGGCATAGAGAGCTGGTACCCACGACGG
ATCGGAATTGTATACTACTTTTTTCAAATGCTTTTATATATCACCTGCTGTGCCGTTGGTTGCGTTTGCTGCTTTGCTTG
CCTGGCTGATGTATCTGCTTCACCCGCTGCCTTTGCACTGCTTATTGCTGTACACTTGCACCTTTTGTTCTCCTTTTGAT
TCCGTCAGACAGCGTGCCTTGGGTGTGGGGTGACAGGGGTAGAAGAGGCCGGGAGATTGGGAGAGTGCTCCGTATTGGAA
GGAATCCCTATTGGATGCTTTCTCAGGCTCACCCTTGTACAAGACGCATGAAAGAGAGGAAAAGACAGCAGACAGAATGC
AAGTGTATAAGCTGGCGAGTGGCACCATGGCCCATTGGCCCATAGTGTGGCAACATCACCCCTGGTTCTACATATCTTTT
ATCCATCTCACTAGGTAGTCCCCCTTCCCGTTCCACCATCCGCCACCCATGCACAACTTTCATTATTCTTGGCCCCCACA
CACCCTCTTTCCGGGCGTCGCGGAACGCTGACATGCCTGATTGTTCCAGACGGTAGCGGGGAGTCGTTTGTCGACGACAG
CCAGCACCAGCACCAGCACCGGCCGTCTTCACTTGGCAGCACCGGGCTGGCACCGATCGCAGCCACGGTCCCAGATGTCC
GGCCGGCCCACGTCTTCAGCTCCTACGACGGATACCACAGCGGGACACCCAACGTGCTGCCGGCCATACCGGCGCCTGTG
GCCATCTCTCATGGCTCCGTGGGCATCGGACAGGCTAGCACCAAGAAGAAGGTGCCATCACCAGACGGACTCTTCCCCGA
CCTGGCCGAGGCCAAGAAGCGCAAGTTTGTGTTGGTGGAGGATCGCGGCTCGCGGCTGCGCGTGCGCGTCACGCTCAACA
TAGTGGACACGAGCGAGATCCCGGACTCGTTCCGCCGGTCCAACGCGGTGTTTCCGGGGTCTTTCTTTCCGATCGAGATG
GAGAGCCCGCCACCGAGTCCGACGGGCCGGTGCTTCTTTCCGGGTGACGTCGACGACTACGACGGCGATGAGGTCGAAGC
CTATGACGGCAATGCGGCCGACCGCGGCCGACGACGGCCACAGCCCCGGCGCGTCGTGGCCAGCGCGACCACGATGGCCT
CGGTGCCGGTTGAGGACGGCGTGGAGGCCGAGCTGGAGGTGCCGCGCATGCGCAAGGGCCTGCGGCGGAAACAAGTGCGG
CTCAACGACCTGGGCTGCCGCATGGCCTGGCTGCAGAGCCGGGCTTTTGCGGGGCGGCGCATCTTTTTGCAAAAAGCCTG
TAAGTCGTCCGGAAAGGCTGTCGAGAAGGCTGTCGACAATCCCTTGATGCTGACTAAGCAGTGGATACGTACCGCACCAA
GACGTGCAACAGCATCGTGGCGGCCTCGCAGGTCGTCAGCGCCATTGCGCCGCACTACGAGATGCGGCTGGGCAAGAAGA
AGTGGATGTCGTGCGAGCGGGACATGGAGCTGCGGCAGGCTGGCCGGATGTGAGGTGTCATCAAGCAACACTGTGCCTAA
TGATAGAATCGTAATAATATATGACTAACACGACAGCAGCTCTCCCGTAAGGCCTAACCCCGACAATGCTGACATAATGC
GACACCCCTCCTCCTAGTGCCAGAATGCGAGCCTTTGGAGGCTGCCGTTCTGCAACCTCTTCACAAGGCCGAATGCAGCC
GAGATGAAGCAGCGATTCTCTTCCCTCGACGTGCGGGTACGCTGCACACCTTATGCCCGTCTTTCTGGCGCCCGGTGTCT
GGCCGTGCAGCCCTGCTAACGGCTTTTCCAGGCTATCAGCCACGAACTGCACCACAGTCTTGCAGGGACGCGCGTGACAA
ATGTCTACGACCTCGTGCCGCCGTCGTCATCGGCATCGTCGACCGCAGCCTCGACGTCCCGTGCCCTGCTTCTGCGCTTC
TCACGCGGCCAGGACAAGTTCCAGCTGGTCGTCGACTCGGGCTTCCGCTGCCACCTGACAGCCTATGATGCGCGAGCTTC
GGCAGCATCCAAGGGCAGCAGTGCAGGCAGCGCACCGCACGCGCCTTCCGCGTTTGTAGCCCGGCTGCGCACCTTCCTCA
ACGGCCGGCACGTGACCGCAGTCCAGCAGGTCGGCACCGATCGCATCGTCGAGCTGCGCTTTAGCGACGGCCAGCTGCGC
CTCTACCTCGAGTTCTTTGCGGCCGGCAACGTCGTGCTGACCAATGCCGAAGCCAAGGTGCTCGCTCTCCAGCGCACCGT
GGCCGCCTTCCGCAGTGCCAGCCTCGACGTCACCCTCAACGTCGGCAACCCCTATGCGCTGGCCGCCAAGCAGAACGTCG
CCGGCATCACCCCGCTGACCGTTGAGGCTGTCAAAGCTGTGCTGCAGGCAGCCGTGGCCGCAGACGCTCCGGCGCCTCTG
ACGGCTGAGGCTGCCGCTTCCACTGCCACTGTCGTTTCGAAGAAGAAGAAGAAAAAGGAAAAGAGTGTCAGCCGCACGCT
GGCGCTTGCCTTCACGGACTTGCCGCAGGTTCTGATCGATCATGTGCTGCTGACCAGCGGCTTCGAGACCACAGAGACGG
CCGGCCTCACAAAGGCTGCCGCTATCCTGGCCGACGACGTCCGTCTCGACGCTCTCTTCCGCGCGCTGCAGGAGACCCGG
ACGCTTTCGGATGGACTGACAGCGACGGGACCAACCTGCCAGAGCTACATCGTTGCCACCAAGGAGTCGGCAGACACAGA
CGCCAGTGCAGCAACGACAGAAGAGGGCGGCAGTGCCATCCCAGTCCCCGCATCAACGAAGCTGGACTACGTCGACTTCC
ATCCGTTCAAGCCGCGCCAGTTCGAGGCCGATCCGAAGTGCGTGCTCCTGCCGTTCGACAGCTTCAACAAGGCCGCAGAC
GAATTCTACTCGCACCTGCAGGGCCTCAAGGCCGACCGCCAGCTCCACCAACAGGAGTCGGTTGCATTCAAGAAACTCGA
GGCCACCAGGCGCGACCAGGCCATGCGCATCGAGAGCCTGCAGGAGACGCAGCAGCTCAACACGCGCAAGGCAGCTGCAA
TCGAGGCCAACCAGGAGTGGGTGCAGGCAGCGATCGACGCGGTCAACGACCAGCTGCATGTCGGCACGGACTGGGAGGAC
CTGGCGCACCTGATTGAGAACAGCGCCGACAGCAACCCGGTTGCGGCTCTGATCAAGCTGCCCATGAGGCTGGCCGACGG
GATCATCACGCTGCAGCTCAGCGACGAGCCTGCGGCCGACTTTGACGAAGACTTTGACGAGGACGAAGAAGAAGCTGAGG
AGGAGGAGCTGCTGGATGTGAACGTGAAGCTGGCCCTGTCGGCCTGGGGCAACGCGCGCGAATACTACGACCAGAAGCGA
GTGGCAGCGTCCAAAGAGCAGAAGACTAAGGAAGTCACGTCAATGGCGCTGCGCAACGCCGAGAAGAAGGTGGCCGAAGA
GTTGAAGCGGGTGCAGAAAGGCGGCAAGCCGGCGCCGCAGCTCATCCGCCGGCAACTGTGGTTCGAAAAGTTTCTCTGGT
TTGTCTCGTCGGACGGCCACCTCGTCATCGCCGCCAAGGAGTCACAGCAGTGCGAGCTGATGTACCGGCGCCATCTCCGC
CGCGGCGACATCTATGTGCACGCCGACATCCGCGGGTCCCCGGGAATTATTGTGGTGAAGAACCGGCCGGACGTCGGCGC
TGATGCGCCCATTCCTCCCGGCACGCTCGCCCAGGCCGGCTGTCTGGCCGTGTGCGCCTCGGAGGCGTGGGACAACAAGG
CAGGCTTTGGCGCGTACTGGGTTCACGCAAATCAGGTGTTTAAGACCACTGCGAGCGGCGACGTCCTTCCGCTCGGCTCG
TTCGACATCCGCGGTGAGAAGAACCATCTGCCTCCGCCGCAGCGCGTCCTGGGCTTCGGCCTGCTCTTCCAGATCAGTAA
TGCAAGGACGGCAGACTATGCCGAGGTCGAAGTCGCAGGGGAGGATGTGGCTGACGACGTGGAGAGCGACGGGCCAGAAA
TTGACAGCTGCCCGGTAGAGGGGAATGCGCAGGAGTCGGAGGTGAAAGACCAAGAAGATCCAGTCAAAGATGAGTCAGCC
GAGAAGGATGAGCAGACCGAGAAGGATGAGCAGGACAAAGAGATAGTCGAAGAGCCAGTCGACCTTGAACACGACGATAC
CCAGTCTGTCTGGAAGGGCAAGGGAAAGGAACGACTCCGGTCTAGCTCACCAGTGCCGTCCTACACGTCCACAGCCCGAA
CCGGAGCTGCCGGATCAGCCAAGCGCGGCCAGAAGGCCAAGGCCAAGAAGCTAGCCAAGTACAAGGACCAGGACGAAGAG
GACAGAGCACAAGCAGAGCGGCTGATTGGCATTGCGGCTGGTCGCGAGAAGGCCGAGGCCAAGGCACGCGCCCAGGCCCA
GCGAGCAGCCGAGCTGGCTGCATATGAGGAGCGCCGACGGGCGCAAAGAGAGCGACAGATCCAGGCGACACGGGCCTTTG
AAGAAGCCCGACAGGCGAAGCTGCTGGCTCTTGCTGAGGCTGGCGGAGACGAAGACGACGACGGTGACGGTGACGGTGAC
GGTGACGGTGACGGTGACGGTGACGGCAGCCTGGACACGATCGACACGCTGGTTGGCCGGCCAGCTGTGGGCGACGAGAT
TGTCGAAGTAGTGCCAGTGTGTGCGCCCTGGTCAGCTTTGGCGCAGCTCAAGTACAAGGTGAAGATTCAGCCCGGCCAGA
CAAAGAAGGGCCGGGCCATGCGCGATGTTCTGGAGCGGTGGCGACAGGCCGGCGAGGCTGGACGCAACGGCAACAAGGGT
ATCTTGGACGAGTCGAGTCAGGATCCCGAGCGCATGTGGCCGCGAGAGGTCGAGCTGATCCGGGGGGTGAAGATGGAGGA
GGCGGCCAATTGCGTGCCCGTCAGCAAGATGACGCTGATGCTGGCCGGTGGACTCGGAGCCGGAGGTGCCGGAGCAAAAA
AGACCGGCAGCAATAAGGCCGGACAGACGTCTGGCAAGAAAGGCGGCAGTAGAGGTGGGGGGAAATCCAAGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62