GenePrediction:GLEAN_4228 Details

Name: GLEAN_4228
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:89166..85849 (- strand)
Length: 3318
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:89166..89021 (- strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_160:88776..88254 (- strand)
Length: 523
Type: CDS
Source: GLEAN
Position: GCSC_160:88203..88072 (- strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_160:88007..87995 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_160:87909..87515 (- strand)
Length: 395
Type: CDS
Source: GLEAN
Position: GCSC_160:87446..87379 (- strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_160:87313..87163 (- strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_160:87087..87030 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_160:86953..86766 (- strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_160:86697..85849 (- strand)
Length: 849
>GLEAN_4228 class=GenePrediction position=GCSC_160:89166..85849 (- strand)
ATGGCCGCCTCCGGATTGGCCGCCTCAGCCTCTCCTCCCGGTCCTGCCACTATGCCTTCGATGTCAGCCGCCTCTTCTGA
CACCCATAGCCCCACCGATGCTGCCAATAGGGTGATCAAGCGCCGTGCACCTGTTGCTTGCCGCAGGTAAGTGAGCGAGA
GGGAGGAAAGAAGGGGGGGAGAGAAGAAAGGGGGAGAAAGGAAAGGAACAGAGCTCCCGCTGATATTTGCAGGTGCCGTC
GCATGAGAAGCAAATGCATCCATAACGGTGCCCGTCCACCCTGCGAAGGCTGCCGTAACGCTGGCGTGAGCCTGGATGAA
TGGTAGCCTCCTCGAATCCGTCACTGTCCTCCCTCAGCCGCCCGCTCGCTGACACACCCCTTCCCATCAGTGTCTTTCCT
TCTCGTGGCGCTCCCGACCTAGACCGCGAGTACCGGCACCCGCGCATGAAAGGCGACAAGGCCCGGAAAGAAGGTACTAG
GCCTGTTCGGTCTGACAGCGTCGGCTTTCACCACATACCCCCTGATCCTAGCTTGCATGATATTACCAACGATGCAGATC
CGTGGGATCTGCTTCCGCCACTGCATCTCATAGTAGATGCTGTCAACATGTTCACACACCAATACTTTCAACTGGGCTTC
ATTCCAAGAGACACCTTTGCGGAAATCGTGCGCAATGACACGCGTTCTGTTAGCCCATTCCTGCTGTTTAGCATTCTCAG
CGTGTCGGGACGCTTGACAGACTCTCTTGTCACTACCTTTGGCGATACTGAGACTGCGTCCGAGCTGTTTATGAGTCGGG
CCTCGGCCATGGCCCTCAGAGAGCTGTACGAAGAACCCACTCTGGCCCGGTGCCAGGCATTTTATCTGCTGAGCCTTGCC
CAGCAGGGCAGTGGATACAAAAACAAGAGCTATGTACGAAGTCCCTCTACCGATCCGTCGTCATCGGCATCTCTCTCTGA
CAGGTCCGCCAGCTTAATTTGGGAATCGCTATTCGCATGGCCCTTCTCATGCAGCTTCATCGGGAGGAAACTTATGTGTT
GGAAGATTCAACACCTAGCATGATCCAAGAAGCGGAGTCGGCTCGAAGAACTCTGGTATGTTCCCGTCTCTTCCATTCTG
TGTCTTTAGTGGTTTCGCTGTTGGACTAACTTTTTATAGTGGATGCTTTACAGTAAGGCATACAGTCCTGCGTCTGTTAC
GCTTCTCATATAGCCTCCCCTACTTCCTTTGCGGCCTGTTGCTAATGCGCCATGCAGGCCAAGATAACCTGCACTCAGCA
CCGTCAGCACCAGTATCCCTCGCCGCCAGCGACATCACCACGCTGCTACCTTGCAACGAACGCGACTTTGCCGACGGCAT
CCTACCCAAGAGACGTGCTGCTTTGGAGGACACACAGCCAGCCATTGAAAACCCATCTCTCGTCAGGGTTCCTGAGCGGT
CGCTATTTGGCACACTGATCCAGAGCCACCGACTATGGGGTATCGTCAGTCGGCGCGCCGTCCGCAACGCTAGATGCATG
GACCCCTGGGCAGACACCAGCGATTACGCCCAGATTCAGAAACAGCTGAGTCAATGGGAGGACCAGCTACCTCCTGACCA
TCTCTGGAGTCCTGCACAGTTCAAGAAATCAAAATCCGAATCCTACGATTTGGTATGCTTTCCCTCGTCATATCCCGTTC
TCCTTTTCGGGGAACCTATCTGCTGAACCTCTCATCCCAGGCGTACCTTATTGTGACCATGGTCACGCGCTTATGCAATA
TTATCATACGAAGAACATACCTCCCCAGGTAAGCAAACCACCACTACGTTGCCGTCCCCGATACGACTTTTCTGACCGGG
CAACTGTCTATAGTATGCTCCAACAAGGGGGGAATAGCTTAACCGAGGGCTTTTGGGGCGATATGTCCTTGGAGCTATTT
GCCAACGTCAAAGACCTCTTCACCCAGATTGACGTATGGTTCCTGGAGAGGCGGCCGGGTGACAGTACAGGCGCCCAGAT
GGCGGTAAGTTGACTGCAGGTAGTTATGCATATAGCTCGCAGAAGATTGCTGCACCCTTGCTAAAACACGGTACAACAGA
TTTTTTGTGTTTACAGCTGTGGCCTGATGGCAGCTTACCTCTGCAAGTACCCACACGGTGAGTAAAGAGCCGGAAGAAGA
GAAGTGTGGCTTGTGCTGTTCTGTCGCCTCAACGTGACGCTAACGGGATACAGTTTGCCGCAAATATGCGCCTGAAGGAA
AGCATATGTTTGATCGCACACGGGACATATTAGCACAGAGCAAGACGGTTTGGCCACTGGCCAAGCGCTGGCTTGGAAGT
CTAGAGAGGTTTTTCACAGTCGATCAGAAGAACATCAGCAACATCGCGTCCGGCCATCTCGAGGGCAGCATGGCTGAGGG
TGTCAGTTTCCGAGGCGAAGCTCTCGCCATCCCATCTGCATTCTGCCCATCGTCGCTAATGTCAAGCAGAAAGACCCGAT
CCCGTCGGCTCTGCACCCGCCGCTCACCAATTCGAGGCCATCGGGCCCGCCAAAGACACCTCTGGACGACAGACAGTACG
TGGCCAAGCAGCTACGGCCGGACAGCCCGCATGTGCGGTCTGCTAGCCCTGGCAACATCTCCAATAGCGCCAGCGCGGCC
CAGAGATTGCCTCCACAGCTCCGAACAAATGACTCACTCCTTAACGGACGGATGCGGCTGCCACCGCCCAACCCATCGCC
AGTTCTGGTGACAACGACGATAACGTCTGCACCACACTATTCGACGGCACAACACCCACACTCACAGCCCGCGCAGTTCC
TCCCACAGCAACTGCAATACCAGCTGCACCAGCCGCCACCTCAAGCGCTGTCTTTATCGACGTCCCAATCGATGGTTCCG
ATGCCCCTCCCGCAAATGCATACTCAACCGCTACCACAATCGGTGCCACATTCGCCGATGCACCACATACCTGATGACCC
TGTAACTGCCAATGCTAGCACGGGTGTTCCCACCATCACGACTACGCCAACAAACATGACAACCGCCCTGAGCCCTTCCA
TGACGTCCGCTGTCACACACAGCAACATCGATTTGCTCGTGCGAGCCTTTGACCCGCCTTCATCTTCCCAGATATCTGTA
CCACACGCGGGCGTATCATACTCCCACTTGCCACAGCAGGTTCTTCTCTCAGACGGAACAACCGCAACTGCGCCCTTTTA
CGAGCCTTCGTACGCAGTGCCAGTCAATGACGGGTTCGAGAACGAGCTTGCTTTCATGATGGTAGGATCAGAGACTTCGG
CAACGACACCTTGGGCGCCGAGCTTTTTCCGATACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62