GenePrediction:GLEAN_4230 Details

Name: GLEAN_4230
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:72949..72435 (- strand)
Length: 515
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:72949..72894 (- strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_160:72833..72649 (- strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_160:72592..72435 (- strand)
Length: 158
>GLEAN_4230 class=GenePrediction position=GCSC_160:72949..72435 (- strand)
ATGGCTCCCGTAAAAAAGCCGGTCAACTGGAAGCTCTGGGGCAAGATGTCTCTCGGGTGAGCTTCGTCCCGCCTACTGCT
CAGTCGCCACTCCCATGCTGACCCTTCACCCGCCAGCGGCGCCGCCATGATTATCGGTGGCCCCATGCTGACAATGTACG
TCATGCCGACGGACGAAGAGCTGTTCAAAAAGTACAACCCAGAACTGCAGAAACGCAGTCTGGAGCGCCGGGAAGAGCGC
CAGCAGGAGATCAACGACTGGGTGGCCAACCTCAAGCGCCAGTCCCGGAGCAAGAAGCCGAGTATGTCCTTCTTCCGCCG
CCTTTGTCTGGCCCACAGGCTAACAGCCGTCCTTCAGTCTGGGTCGTCCAGGAAGAGGAGTCCCGTGCGGCCAAGGAGGC
CATGCTGCGTGACACTGCCCGTCTTGCCCAGGAAGCCAAGGCCCAGCGCGAGGCCATGCGCAAGGAAGCCGGCCTGGCAC
CCGAGTCCGATCCAGGCCCGGGCTCCACGAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62