GenePrediction:GLEAN_4231 Details

Name: GLEAN_4231
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:69855..69160 (- strand)
Length: 696
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:69855..69773 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_160:69649..69477 (- strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_160:69413..69160 (- strand)
Length: 254
>GLEAN_4231 class=GenePrediction position=GCSC_160:69855..69160 (- strand)
ATGGCCGATATCCAGGAGCGCTTGAAGAAGCTTGGCGCTGTGTCGCGTACCGGTATGTTGAACATCTGCCTGGCTGCGCA
CTCGTAGCGCTACTTTCCACGCACTATGTTGCTAACCATTTGCAGGGTATGTTCCTTTCCCTTCAGCAAGCACAGCCAGC
ACAGCAGTGCCCAAGCTCCAATGTGTTCGTCACTAACCTGCCGCAGTGGCAAGGGCACGCCCCGGAGAAAGGTCAAGCGC
ACGCCTGGGCGGTCCGCTGCCGACGACAAGAAGCTGCAGCTGAGCTTGAAGAAGCTGAACGTGCAGCCGATCAACCAGAT
CGAGGAGGTCAACATGTTCAAGAGCGATGGCAATGTCATCCACTTTGCCGCCCCCAAGGGTGAGTCTCGACAACGCTCCA
GGACACGAGGCCGGTGATTGTGCCCGCTAACTATTCGCCCAGTTCACGCTTCCGTCCCCTCCAACACCTTTGCCATCTAC
GGCAACGGCGAGGACAAGGAGCTCACAGACCTCGTCCCCGGCATCCTGAACCAGCTGGGCCCTGATTCGCTTGCCTCTCT
CCGTAAGCTGGCTGAGAGCTACCAGAACATGCAAAAAGCTGGCGAGGACGCCGAGAAGGACGGTGCCGCGGACGCCGAGG
ATGACGATGCCATCCCAGACCTCGTTGACCGCACATTCGAGGACAAGGTGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62