GenePrediction:GLEAN_4232 Details

Name: GLEAN_4232
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:66852..66123 (- strand)
Length: 730
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:66852..66802 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_160:66621..66478 (- strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_160:66410..66123 (- strand)
Length: 288
>GLEAN_4232 class=GenePrediction position=GCSC_160:66852..66123 (- strand)
ATGCGTACCTACGACGACACGTTCTCGGGTCAGAAGATCTACCCTGGAAAGGTAAGATTCATGAACATCCGGCGAGCCAC
ACGCGGATAGAATAGGAGATGCGCGCAAGTCACGCCGACACTCAGCGAGAAGAGAAGAATTGTGGTCTACTCCGGCTATG
TTCAGAAGGCACCGACACGCATGGTCTACGTGCAAGCTGGAGTTTTCACGGCTAACCCTAGTTCTGTGCAGGGCAAGATC
TTCGTCCGTGGTGACAGCAAGGTCTTCCGTTTCCAGAATGGCAAGTCCGAGTCGCTCTTCCTACAGCGCAAGAACCCCCG
CCGCATTGCGTGGACCGTTCTTTTCCGCCGGCAGCACCGCAAGGGTATCTCTGAGGTACGAATCATCGAACAACACCTAC
CTAGTGGAATCAGCAAAGGGAAGAAACTAATTCATATCACAGGAGGTCGCCAAGAAGCGCACGCGCCGGACGGTGAAGTC
GCAGCGCGCGATCGTGGGTGCTTCTCTGGACGTCATCCGAGAGCGGCGGTCTATGCGCCCAGAGGCTCGGGCAGCTGCAC
GGGCAGAGAACCTCAAGGACATCAAGGCAAAGAAGGCCGATGCTGAGAAGGCAAAGAAGGCCGAGAAGGCCAAGAATGCA
GCCAACGCAGCCAAGGGCCAGGCCGGCCGTATTCAGAGCAAGCAGGGTGCCCGGGGTGCGCAGGTCAAGGTGGCTGCTAA
GTCCCGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62