GenePrediction:GLEAN_4233 Details

Name: GLEAN_4233
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:65411..63852 (- strand)
Length: 1560
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:65411..65104 (- strand)
Length: 308
Type: CDS
Source: GLEAN
Position: GCSC_160:65032..64890 (- strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_160:64798..63852 (- strand)
Length: 947
>GLEAN_4233 class=GenePrediction position=GCSC_160:65411..63852 (- strand)
ATGGTCTACCTACGACAAGATTCCCTTCGAGGGCTCGATCTGTACAAGTACTCGGGTGTTGACCACAGTCTAACATCCAA
ATACATCCTTAAGCCGTTCTACAACAATGTAGTGCTTCCTTGTTTCCCAATGAGCATGGCACCCAATCTCATCACGCTCT
CTGGGTTTATGTTTATAGTCTTCAATCTGTTCACGCTACTGTGGTACAACCCATCACTCGCTCAAGACTGCCCGCCCTGG
ACCTACTATAGCTGGGCTATAGGTCTATTTTTGTACCAGACTTTCGATGCCGTCGATGGAGCACAAGCGTAAGTGTTTGA
GCTGCAGCCGTCGAATCGGATAGCAGTACAGCTAGGGGCAAGGGAACTGACAGCTCTAGGCGGCGAACGCACCAAAGCAG
TCCGCTGGGCGAACTCTTTGATCACGGCGTTGACGCACTAAATACGTCTCTTGAGGTCCTGCTTTTCGCTGGCTCGCAGA
ATTTGGGCCATGGCTGGAGGACAGTGGCAGTGTTGTTTGCATGTACGTGCGAGGGTTTCCAAATTCTCAGAGGCGGTCAA
TCATTGCCTTCCACTCTGGATTGGGTTGTTGTCCTTGCTAATTTAATTGCCAGCCCTCATGACGTTTTACGTGCAGACCT
GGGAGGAGTACCATACCCACACACTGACGCTTGGCTTCGTTAACGGACCAGTTGAGGGCATTCTTATTCTTGTCTCGGTA
TATGCTCTCACGGGCTACCTCGGTGGCGCTTCCTTTTGGCAACAACCTATGCTTGCCACGTTGGCAGCTCCGGATAGCGT
ACTGGATCTTCTTCCGCCTGTGGTCCGCGACCTATCTTTTACCGACTGGTACTTGGTGCAGGGCAGCCTTGTTCTTGTGT
ACAACACGGCCGAGTCGGCACGAACGGCAATTGGCGTTTGGACCAAAGAAAACAGGGAAGCCAAGAACAAAAAGAGCTAC
CGTGAACATCCAATCCTCGGCCTCATACCCTTCTTTGTGACCTGGATCTTGGTCGTGGCATATCTGGCACTGCGGCCAGA
AATTCTACATGCTCACCTGGTACCGTTTGTGCTCTTCGTGGGAATTGTCAATGCTTACTCTGTAGGCCAGATGATTACGG
CCCATGTGACACACATGTCCTTTCCTTACCACAACGTGTTGCTTCTACCGCTAGCCTGGGGTGTTGTGGATTCACTCGGC
CCGGTGCTCCAGCACCTAGAGCCAACCGTGGCGCTGATGCTTTTTGGGCCCGGCCAACCCCCAGCAGCCTTTATTCTGGG
CTGGCCTAGTGTTCTTGGCGACGGTGTTTATCAGGTTGCATTTATGTTCTGCATGTTGGGAACAGCTATCGGCGTGTATG
GCTCCTTTGTTGTCGACGTCATTGTCACCATCTGTGACTATTTGGATATCTGGTGTCTCACCATCAAGCATCCATATATC
GAGGGAGCTGAGGCCGAGAAGAAGGCGGCAGGGAAAACCAACGGCAATGTGAGCAACGGGAACCTGGCAGCATGCACAAC
CGCCACAGCCGTTCCCGATGCGGCGACTCGGCGAACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62