GenePrediction:GLEAN_4235 Details

Name: GLEAN_4235
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:54651..51118 (- strand)
Length: 3534
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:54651..54579 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_160:54511..53784 (- strand)
Length: 728
Type: CDS
Source: GLEAN
Position: GCSC_160:52476..52283 (- strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_160:52210..51118 (- strand)
Length: 1093
>GLEAN_4235 class=GenePrediction position=GCSC_160:54651..51118 (- strand)
ATGCCGAAGGAGCGAAACTACAACCCCGTCGCGGCACAGCGAAAGGCTGATAAAGCCAAAGACATCAGAAAGGGTAAGTC
TTCCAATTGTAGCACAAGAATCCATGCTCTGGACTGATGATAGGTCGGTCTTGTTCACAGGAAAGGCGGAAGCGACGGCA
GCACGCAATGAGCGGTTGGCAAAGAAGAACCCCGAAAGAATTCGGAAGCAGATCGAAGACTATAATAAAATAACAGGCGG
CGGTGGAAAGCTGACAAGTCACGATACACAAGTGCTGGAAGGCCTGGAAAAGGAACTGAAAGCGGTAACCAAAGCGCGGG
AAGCGTTAGGAGAAAGGGCACCAACGTTTGGTCGGACTGGCGGGGGTCCAGATCGTGGACACGGCCATGGAGATGTGCTA
GGGAAGAGGAGAAGATACGATGGCGAAGAGAGCAGTACCGACGACGATGTGCCAGAAGACGTGCGAAGCATCCCCCTGCC
CCGCGACACACCGCCCCCGATTCCGAAGGAAATCCTCGACAAATGGTATGCCAAGCGGCGGGCAAAGCGGAATGCAAACA
AGGAGCCTCTAGGCGAGAGCCGCGGAAAGGGTCGAGGCAATGGCCATGATGAGACAGGCCAGGAAGCGGCGTCGGCCAAC
CCCCGTACTACGCTTGCCAAACCGCAAGCGAAGCCAGTCGAGGTCAAGGCTGTGTATGAAGCAAAGCCGGTTCTCAGAGA
CCTGCACAAGGAAGCTGTGACTGCATTTGTGCCTGCGGTAGTGCAACGAAAGCTCGACAAGATACGCGGCAAAGGCGGAA
CTCTTCTAGAGCCGGAAGAAGCTGACCGGTTGGAAAAGGAGGGCTACTTACATCCCTCTGGATCTGCTGTACGTGATGCA
AGCGTCAGTAGGATCGCAACTACGAACACAGAAAGGGTACAGGGGAAACATCCAGGTGAATCCCCGACCACGATGGTTTC
AAGGCCTCGCGAGGTCACTATTGAAGATGTGGATGACGAGGAAGGGTGAAGGAATATGCCAATGTGATGTTTTATCAGTT
TCGAGCAACAAGAGAGCCCTGCATATTGCAGAGACCGTCTTGGACATCAGCACCTATCATTCCTCAATGTGATATTACGG
ACCTTGGTGTCACACTGCAAAAAAAGACCAGGACGTATCGAGAACGTGCCAGCCAACGACGACTCTAACGGCCAGAAGTC
ACAGGAGCCGGTAGAGTTGTTGTGTCTGTATGCTACACAGGGGTGATAGACGGAATCGCCCAACTCCATCGTGTCTCTGT
CGTTAGTCAGCGCGACACGAGGCCCAACGACGGCGGAGATCAAGGGTAAAGCCGCCGCACCGTTGACAGGTTCGTCGTCA
TGCACGATCGACCTTCTACTTGAAAGCATGCTAGTGCGGCTTTTGCCGGAGACAATGTGGCCTGGCAAGGTCGTGTCATT
TGCGAGTACTCCGTACTCCGTAGCTTGCGCTGAGTTCTATTCTTAGTTCGTGCTTCTACGCGAATTGCCCCTCCTGCCTT
CTGCAGCATAGCGGGACAGCAAAGTCGGGATTGTCTCGGCAGCCCGTGTCGATCTGGCAAGCAAAAGCAACCGTTGGATG
TGCGAAGTGTATAGAACCGGTAGCTGACATTCTAGTAAGCATAAACGTAAATAGCGGCCTTCATGCCTTCGAACGAGTAC
AAAAATAGAGTTTTGATCAGCAGAAGTGCTCGTGTTCCCATAGGTCGTGCTGCTTCGGGAAGGTGTCCTTTACCACCATG
ACAATTGGTATTGAAACACGGTGGCCATAAGACCGTCGCATGGTATTAGTCAGTAACGGCAGACAAAGCGCGACACTAGA
CAGACTGCTGCAGCCAGATAGAACAAACAACCAAACAAGTATTCGAGCAATTGAACTTTGGGAATGCTGCTACCGGCCTC
AGTTTAGGATTTCTCTCCGTTCAGCTTACCATTTCTGTTTCTGTTTTTCTCCATACCTGATCTGTCTGCGACGTTTCCTT
GGCTGTTCTCAATCCTTCTCTGAAGCCTGCTCATCCATCGTAGGTACAAGCGTAAGTGATGGCAGGCCCGGTCGATGCGG
CGACGCGAAAGAAGGTCTTGAAGGTTATCGTCGTTTCGCTTCTTCTTGATTTGGTATGTTGAACTTCTCATTTCTTTCTG
ACCACCCGACATCAGCTAACGGCCAGCCAGGTATCCTTCACTTTCATCCTTCCTCTGTTTCCCAGCCTGCTCGAGTTCTA
TCGCCAAAAGCCCACGCAGTTATCTACCGTTTTCGACTATCTAAATGCGTACAAGGCATCGTTTGCACGGCCTATCGACT
CTCGTTATGATGTTGTGCTGCTGGGCGGCGCACTAGGGAGCCTGTTTTCGTATGGTTCCCAACCCATAGAGACATAAGCA
GAATGCTTGCCCGCAGAGCTAACGCTTATCGGGGTGTTCAGAATTCTGCAGGCCATTGCCTCCCCTGTCATCGGGCATCT
TTCCGACCGCCATGGCAGGCGCACGGCACTGCTAGCTAGCATGGCTGGCAACATCATGTCGGTCTTGTTGTGGGTTATGG
CTGTCGACTTCCGCACGTTCGTACTGTCACGCGTTGTCGGTGGCTTATCCGAGGGCAACGTGCAGATGGCCATGGCTATC
GCGACCGACATATCAGACGATGCCAGCCGCGGCTCGACCATGGCTCTCATCGGAGTATGCTTTTCCGTGGCTTTCACATT
TGGGCCTGCACTCGGCGCTTGGCTGAGTTCTATCGATACATTCAAAGCAAACCCGTTCGCTATCGCCGCTGGCTTCTCCC
TATGTCTGATCGTCACTGAGACCGTCTACCTTTACAACTATCTGCCGGAGACGCTGCCGGACAAGACCGAGAAAGCAGCA
GACAAAAAGTTAGCGGGCAATGATGAGAGCGAAAAGGACGGCAAGTGGGCAGAGCAGAAGTCGCCGAGTCCGACTGTCAC
ACGTACCAACTCCCATTTTGTGCTCAACCTGGTTCATTTTGCCTTTCTTCTTTTCTTTTCCGGCATGGAGTTCTCACTGC
CATTCATGACGTTTGATCTGTTCGGCTACGGGTCAGCTAAGAACGGCCGCCTGCTCGGTTTTGTAGGGTTGGTGGCCTCG
GTACTTCAGGGTGGCGTCACACGACGCCTACCTCCCCTGCTATCCATACGCATCGGAGTGCTTTCTTGTCTAGCCGCTTT
CTTATTGCTGGGCAGTCTCACTACGACTGTGATCCTTTACCTGGCCGCTGCGTGTCTTGCTGCCACATCTGCCACCGTCG
TCACTGGCCTCAATGCTCTCAGTAGCTTCGAGGCTCATTCTAGCGAACGAGGCAGCAAGCTCGGTGCCTTGCGTTCATGG
GGCCAGGTAGGACGGGCTCTTGGACCAATCCTCTTTACTACTGTATACTGGTGGGCCGGTCGTACAGTTGCCTATGGTGC
AGGCGCCATTGGAATTACTGCTGTCGGCGCTCTGGTCTTCTTTGCACTCAAGTCACCTACACAATCCCAGGACCCCAGGA
AAAAGACGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62