GenePrediction:GLEAN_4241 Details

Name: GLEAN_4241
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1192715..1191447 (- strand)
Length: 1269
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1192715..1192462 (- strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_179:1192403..1192263 (- strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_179:1192190..1192123 (- strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_179:1191781..1191447 (- strand)
Length: 335
>GLEAN_4241 class=GenePrediction position=GCSC_179:1192715..1191447 (- strand)
ATGTGGTACCGCACAGAGGAGCACGCCAGCCGTGCTCTTATCTGGCAGGCGTCGGAATATATTTTGACCATCTGCACCCA
GCTGATGATGTACACCATCGCCAAACATGCTGAATACCACAATGGCTTGGCAGCTTGGCGCGCTATATCATTGTTCCTTG
GCGCAGCGACTATGGTTGGCGCCGTGGCCTGCTTCTTTGTTCTAGGCACGCCGGGAGAAGTCCGATGGCTCAGCAAAGAA
GAAAAGCGCATGGCGTAAGATATCTTTCTGGAGCGTTGCATTTTTGGGGGGTGCGATTTTGACACCTTTCAGGTTGGCTC
GAGTTGCAGAAAACAAGTCTGGTCATGATACCACGGGCGTGAAATGGTCCTGGCCACAAGTTGCCGAAGCCTTTAAAGAC
CCCCAGATGTGGTTCTCGTTTCTCAACGCATTTTTGAACAATGTTCCGAACGGGTACGTACGATTGGTCGCACGCTTACT
GGGGGCCCATCCTAATGCAGACCACAGCGGCTTCACTACCTTCAGCACATTGATTTACGAATCCTTCGGCTTCAATACCT
GGGAAACGATCCTTTATGGTCTGCCTCGGAACGGTACGTGCTCCATGCCCTGACACGATAAATCTTGTTCAGAACTGAAT
AATTCAGCCGTCGGTTTCGTATGCTTCATCGGAGTTGCTCTCTATCTACGGTACATCCAAAACCAGCGGTTGCTACTAAT
GATAATGGCTTGCATCATATCCTTTATTGGCCTTTTGGCTTTATCACTCCTTCCGAACGACAAAGCACATGAGTGGACGA
AGTGGGGTCTATACTTGATGACGGTGGTTTTCGCCTTTGCTATCTTCGTTGCATGGACCCTAAGTATGTACTCCCTACTC
CATGCTTTCCCCCCCACACCCCCTGCATAACCACACATTCTGACAAGATCATAGTTCCATCGAATGTTGCAGGTGGAACT
AAAAAGACAGTGGTCTCGTCGATGACCTTCATTGGCTACTGTGCTGGAAACATGGTAGGCTCTCAGGTTTTCAAGACCAA
CGATGCGCCGCGATACGTCAAGGGAACTGTGGCTTGTTGTGTTGCCCTTGGGCTCGAAGCTATTGTTCTCCTACTATGGA
GGTTATGGTATATGTACGAGAACCGGCGGCGTGACATTGCTGCCGCAGAAAGTGGCATTTCGAAAGAGGAACAAGAACGC
TTAGGCCGTGAGATGGGTGAGCAAGACATGACCGATTGGGAAAACCCTCACTTTAGATACAGCATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62