GenePrediction:GLEAN_4242 Details

Name: GLEAN_4242
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1188218..1183248 (- strand)
Length: 4971
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1188218..1188185 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_179:1188075..1185140 (- strand)
Length: 2936
Type: CDS
Source: GLEAN
Position: GCSC_179:1185083..1183248 (- strand)
Length: 1836
>GLEAN_4242 class=GenePrediction position=GCSC_179:1188218..1183248 (- strand)
ATGGAACAACCGTGTTCGACATCCAAAGTAACCGGTACGCGTGTTCAGCCTCTTATCTCTGGTGTTTACGGCAAATTGTT
TCGCCTCACTTGAAGCCGTCTTCTATCTGACCGCAGCCTTACTGACGATTAGTATAAATTCAGTTGAGTATTTCGATCCT
TACGGGCTCTACAAGCTTATCGCCCCAGGGCTAGTTTCGCGGTTGCCCTTGCGCCACCTCCATTGGCAGTCTCATTCGGG
CCCTCTCCGATCCATCGACACCCTCCATGTCGAGCTGGTAGCTGCTGGCTCGCCTTTACGACCCCAATCCTCAACGCAAG
ACAAAACTGGAAAACATACGAGTAACCTAGCATCCAAATCCACTGCTGTGGATGATGGGTTTCAAACCGCCACCTTTGGC
GGACGAGGCGTCTCTGTTGAGGACGATGTTGCCGCCGCCGCCGTCACATCCCAAGCACCGACGGCAAAAGAGCGGCGACA
CCAGATTCCTGGTCTACGCCAAACGCCCTACTTGAAAGTTCTGCTTATGAGATGCGACAGCAATGATAGCTACAAATCTC
AGACACGATCCGAAATTCGCGAATGGATCAAGCAACATACAGCACAAGCCGGAAAGAAGTCGAGTGTAGCTGAGAACCAT
GACGCTTTTGAATGGATGATTGTCCATGTGGTTATCCCAAATTCTGCAGCGTACACGCAGCCCCGGACAAGCAAGCAGTC
CGACGGCTCGGCAACAGATCTCACAACCAAATCTTCGTCCCGATGGGGCAAAAGCTCTACCACAATTCTAGAAAAGCTTC
GGTCAGATTTCAACAGCAGTAGTGGGAGTAAGATAATGGACCGGGTTGCACAGATTCGTATCGGGGTCAACGACTTTCCT
TTCGAGCTATTGCCACTCGTCGTATCGGCCGTCCCCGGTGGTCACGCAGAGACGGAGAAGGAGTCACAGAACGCGTGGTT
GGACTTAATCGACAAGTTCAAAGCTCTAATTCTGTCAAGTTTCGACGCTCGGGTCTCTCAGTACGAAGAAGACATTCGAG
AAAAAGACTTGCAGCGAATGCTCCCGGGATGGAACTTCTGCACGTTTTTCATACTCAAGGAGGGCCTTGCCCGCGGATTC
GAAAGTGTCGGCTTGGTTGAAGATGCGCTCGTTGGCTATGACGAGCTCAGCGTTGGTTTGGACGCTGTCATCAAGGAGCA
GGAGACCAACGTCCGTACCGCGGACGTTCACGGCGGTTCTCTGCTGAAGTATACCGAAGACTTGTTAAAACTTGCCCAGG
GGCAAGCGTCAGCTACCACTGTTAGAAGAGGTTCCGAATCTGTTGACGAAGAACCTGTCGATCTGCAGTCAAATGATGAT
GGTATTCTCAGTGACAATGAGGCTGACCAAGTTGACGACATTCCGATTAGCTCAACGAAAAAGGCTTACCGCGAACTCAT
TCTTGCCAACAACGTATCTGTTTTCGACTTCCGTTGCTACATATTTTCTCGACAGATATCCCTCCTTCTACGATTAGGAA
ATGCTTGGTCAACACGCGAAGAGCTTCTTATGAGATTGAGAAGTCAACAGGACTCTGTTCTTCCTACAGCAACGCCCCAT
ACAGCTAGGTCAAAGTCGCCCGACGAATCAGAGAACCTGGCCATGCTCGCAGAAATTTGTAGAAGGGCGTTGGAGTTTAT
ACCTGCCCTGTCTCAAGTGATGCGAGAGGACCTTTTGTACGCTATTTCTCCAACTACCACTGGAGCGAGCTCGGCTGGCT
CTGTGCCGGACGCTACAACAGCGCTTCAAACACTCTCGATTGAGGTGGTGGATAACATGGTGGCATCATACGCGTTTTCC
ATTGCGCAGCAAATTTTAGCGCAGACGGCATCGAAATCGTTACCCACTCCTCCTTCCACGTTGGGCACATCTAACGACGA
GGCAGTTGCCACAAACCCGGAAGCCCAAAGAGATGTGCACCCAGTGAGGTTATCTTCTCTGCACACCAACAGTTATGGAA
TAACCCGAGGCCCACCCAGCCCTGGTGTATTTCCTGGACCTGGATTACCGAAAGACCCAAACCCCGACGAAGGTCCGCAC
TTTCTCAAGATTGGACTAGAAGAATTGGCAGCACGTCGTGCGGATCTGTTTATGCTTTCTCGCGGAATTTTGGAAGAGAG
AGGGAAAAAGGTGGGCTGGGCCGATGGATGGGTATCAGCACCAGCTATCGGTGAAACTAGCGTTGGAGTTTTGGAGGATA
TCGATCTTCACGACACCAGAGGAAACGATGCAAGTGGTGATGGCGATGCTGCTTGTGTCGAGTTGCAAGTTGCAAGGGAT
GAGTCTTCATCTAAACCAACTGCGCTTGCTGGCATCGTCAACGCTCTTTTGCGCACTGCGCTCAACAGTCAAGATTCCTT
TTACAGATTGTATGAGACACTCACCGACAAGGCACTTCGGCACTACACCGTCGCTGGAAACGCCCACTCGGTTCATGCAA
ATCTCGCCGATTTGGCGGTCTTGAAGTATCACTTAGGGGACTTCCCGTCTGCCGCGTCCTACTTTTACGAAACTACGCCG
TTTTTCGGTGGAAGTAGCTGGAATCTTCTTGAGCTGTCCATGCTTGTCATGTATTCATGCTGTTTGAAAGAAATGGGACG
AAAGGACGAATACGCGTGGCGGCTGCTGAAACTCCTTTCAAAAGCTGCAGAGGCAGAAAGGGACAGGATCGCTCAGCAGG
CTTCAATCAGCCCTGGGGGTATACAAGGAAGTAAGTTTATTGATATAGCCTTGCTACAGGGCTATCTCCCTGAGCTGCTT
AGCGCTTCTTGCGAGCTCAAGAAGGAGATGCGTGTCCCTTTAACCAATTTTTTCAACATCTTCGAGGTCGTGGGAGCACC
TGCCTACACTGAAAAGCAGGACAACTTCGCGCTTGTTTTACAATACCACAGCTTGCTGCCAGATGCTCTACCAGTTGACC
ATGTTCGAGTCCGCATGCTATGTGCGTCGAGTAGTGGGCAGCCTCGTGACATTTGGCTGGAGACCAAAGAACCACTGCGC
CTCCAACCTGGAAATGGAACATTTCGCATCTACAGCAATGTAAGACAGCTCTCGATTCTAGTTACTACTGCCTTGAGCAC
TGACGATTGTATCAGACTGTTACTCCTGGCATGTATGTCATTGATCAAGTGCGCCTAGCAAGCAGCAATGTTGTCATCGC
ACATGAACGCCAACCGGCGAATGCCGATGCCAGTATTTTCAAAGAGCCTCATGTCATTGTATATCAAAGGACAAGCGCAT
TTGATGTCCAACTGAACACGTCAAAGGCCCTTCAGCTAGACAGAAACAACCACTTGGAGGTTGAGCTCCTCGCAGGATGG
AATGAGATTACGCAATGCGAACTCCACATACGCGCAGCTACAGGTGGTCTGCGCCTCATCACATCTGAGTCCCAAGTTGT
CGGTTCGCAGCATTCCTTTTTCAGCCCGGCGAAAGGTGGTGTTGTCACTTTCGGCTCGATTGGTGCGGGAACAAGTGCCA
AAATCACGTTTCCCTTCTCTATTGAGCAAGACGTTCTCGACCTGTGCGTAAAAATCGATGTCAGCTACACCACGGAGCAC
GGCGTGTTCAAACTGTCAAAATGCCCGTCTGTCACCACGGCTCTTGCTCTCGGCGTCAATGTACAGGATGTCTTTAAGCA
CAACTTTTTGTTCTCTCGCTTTACCGTCTCCACGGCCACAGCTAGCCCTCTACGACTACTTCGAAGCGAATTGCTCGATT
CCGACCTTTTCTCGTCTGAGTTTGGAACCTCCCCGGAAGTGCCACCGATAGTGTTTCCCAAGCAGCCAGCCAGTTTACTC
TACAGGATAACCCGCAAAGTATCTTCCGCGGCAAGCAAGAACTTGAAAAAGAGCATGCAAATCAAGCTCCATTACAGCAT
TATTCAAGACGAGATTGATGAGCAGCTCGAATATTCGCTCACTGAAGCTTTCCGGGGCACAGATGCATCCATTTACGAGT
TCTCCAGGGTAGCCGTTTCGTGTGTCCTACAGCATATGCATTCCTTTCTCTCGCCATCTGATTTGGAAAGAATCGTTCTT
CTGGGCGAGCTTTCCACCTCATTCATTGGCGGCGTGGATTGGGACCTTAAATTCCCGGGTCTAGGAAGTGACAGTGCTGG
AGTAGATTTGAAAGAGCAGCTTTCTTCGACAATTCGAGGATGGCAAGCGATGACTCCGGTCATTTTCCTCTCGCAGAAGT
CGGCTCTGAGAAAAGCACGTACCATTCTTATCCCTGTCGACATACCTAGTGTGACCATTGTCCACACTGCAGACATTCGA
CTAAAGCAACCCCTTGCCTCATCGTTGGTAACTCGGCACAATAGTGAAATTGTTGCCTCTTTATCCAGACTAGCAACGCC
AATGTTTTGCGTCAATCAACTTCTGCCCGCCACGCTTCATCTTAAGTGGACGCGGTCGTGGGATACCGCTGACATCGGGG
CACAGCCATCAGGGAAAACAGAATCTCAGGCTTCCGAGGACCTGGAGTTCAGTTTCGAAGTGACAGCGCCAACGGATACG
TGGCTTATTGGCGGCCGGCGAAAAGGTCATTTCATTATACCAGCTTCAAATCACACAAGAGGCATCGGATTGACGTCTAC
TCCGGAGTCTGAAGCAGCCATTCCGCTGACACTGATACCGCTTCGAGAAGGATGGTTGCCTTACCCAAGCGTGGAAATTC
GTGAGGTTCACAGCAGTGATGCCTCTGGCGTCTATACGGGTACGGGCCAGCGCGGACCATCCGAGGCGTCTCACGATCCT
CTTCAGAATCGACATCACTGTGAGACTGACTATCGCAACCTGGGTGAGACTGTTCACATTGTAGCCGATCGCAAGCGCGT
GACGCTGAGTTTGGACGCTAGCGGTCCTGGCGGCGGTCCATTGGTTCTCGAAAGTGAACGGCCTGGTATCGTTAGCAGAC
TGGCAGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62