GenePrediction:GLEAN_4244 Details

Name: GLEAN_4244
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1181068..1179975 (- strand)
Length: 1094
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1181068..1181035 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_179:1180915..1180870 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_179:1180803..1180789 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_179:1180715..1180681 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_179:1180608..1180368 (- strand)
Length: 241
Type: CDS
Source: GLEAN
Position: GCSC_179:1180293..1179975 (- strand)
Length: 319
>GLEAN_4244 class=GenePrediction position=GCSC_179:1181068..1179975 (- strand)
ATGGAGTTTGGTACCTCTGGTCATCTTAGCGAAGGTGAGCTTTTTGGGCTATCTGAGAATATATGCACTTATCCCTTCTC
TGCCGCGCCGTAATGGCACAGTTTTCAGGGGGTCTGTATTTTGTTGTTCGTTCTCTAATCAGTAACGTTGCAGATGGTAT
CCACGTCGATATGGATAGGTTGAAGAAAGGCGAGGTCAAGTAGGTGGTCGAAGCATTAAGGCGGTGCCCGCTTTCGTGCC
AAAGCTTTGCTAACACCCTTTGCAGTCTCGGAACCTCAATGTGAGAAGCCACCCTCGGCGAAGTCTCCAAAAACATCACC
GACCGCATCTGAACTGACTAACACGATGTCCAGCATGGCTGTCACTTTCAAAGACGGTGTTATCCTTGGTACGGAACTTC
CTAAGCACGTTGGGAAAATTTACAAGCCAGATCATGCTGACTAGGGACTCATTCGCGCAGGAGCCGATTCGCGAACAACA
ACGGGCGCGTACATTGCCAACCGTGTCACAGACAAATTAACCCGGGTTCATGACACGATTTGGTGCTGTCGTTCCGGCTC
GGCGGCGGACACGCAAGCTGTTGCAGACATTGTGCAGTATCAACTTGGTTTGTTTGCTATGCTGAATGGCAAGCCTCCCA
CGACACAAACGGCTGCGGCAATATTTCAAGAATTATGTTATTCCAACAAAGACCAGTTAAGGTTAGTCTAGTGAACATGC
CCGGGGGAAGCGATCAGGGTATCGTAAATTGGACGCAATTCTGACTTTGCTGCAGCGCCGGCCTCATTATCGCAGGGTGG
GACGAGCGGTATGGCGGCCAGGTGTATTCGATACCCCTGGGCGGTTCTCTTCACAAGCAAGCCTATGCGATTGGTGGTTC
TGGGTCGACCTATATCTACGGTTACTGCGACTCAAACTGGCGGGAGGGAATGGAGAAGGATGAGGCAGTTGACTTTGTTA
AGGGTGCTCTGAAAGAGGCCATTCGGTGGGATGGAAGCTCGGGCGGCGTGATACGCATGGTGGTGTTGACACGAGATGGT
GCGGATCGGCATCTGTATTTGCCAGACACGGGGTACGCAGTGCGCCAGCAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62