GenePrediction:GLEAN_4245 Details

Name: GLEAN_4245
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1178685..1176981 (- strand)
Length: 1705
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1178685..1177231 (- strand)
Length: 1455
Type: CDS
Source: GLEAN
Position: GCSC_179:1177160..1176981 (- strand)
Length: 180
>GLEAN_4245 class=GenePrediction position=GCSC_179:1178685..1176981 (- strand)
ATGGCTGCTCTGATCGGCAGCTTTGCGCGTACCGATCACTCTGCATCTTCAAACAGGTCGCTGTTGCCGGCCCTAGCGTT
CCGGCCACCTCAGCCGCAGCAATCACCACAACGTCCGTCGACCTCCTGCCTTCAACATCCAAATTACATGAAGCATTCGG
CTCCGCCGAATCCGCACTTCACTGGCGGCAACGTTGCCGACCCCCATCCCCCGTCGCCTCCCGGCAGCGTTCCGAAAGAG
ACGTCAACGCTAGCCCCAGCTGTCTCTGCTGACCGACCCGACGGCATCATCAGTGCACATTTTCGGAATCCCTCTCCTCC
TAACTCCTCCTCGCCAACCAGCGTCAGAGTCGCCTCATTCTGCACCCCCCCGGCGAGGGATGGAAGCTTAGCGCACATGG
CATCCACTGACGCCAGCACTGCCCAAGCGGGAGCCATTTCTTCATCCACACAAGCCTGCCAGACAGCTGTGCCCACCCCA
AGTGCAGCTCGGCCTCCGCCCCCAACGAACGCCATCCCCTCGCCTGCTAGCGACACCTACTACTACCCGCCATGGACACC
ATCAGGACCTGATCCCGTGTCCACATCCTCTACATCACCATCTTCACCACCGCCTGCCCAGCGCACGCAGAGGACAATAC
GCATTCGCAGCCTTAGTCACATCGAAAATCTTGCACAGCTTGATGTTTCCACTGGTAACGGGCCTGGCATTCTCAACGAT
CCCCCACTCCAGGATATGAAATTTGAGATCAGCGACATGCCTATTGGTGACATAATCAGCATGGTGGCCGCCCTTCTGAC
CAAAATCACCACAACAAACGACCACCAGCATGATGCATTAAATCGTATTGCAACTCAACAGCGGCAGGCCCAAGTCCACG
GGGACGGGTCAGACACCCACGGAAGTCCCTTTTCAGCGTCTGTGCTCGCCTTCCATGGCAAGAACGTTCCTGCAATCACG
ATTCTAAGCTATCTCACTCGAATACACAAGTACTGCCCTACCACATATGAAGTATTTTTGAGTCTGCTTGTCTACTTCGA
TCGCATGACAGAACGTGTGAACGATCTTGTCATGAGGGATGAGAGAGAGCATAGGAAGAGTGCTAGCCTGCAGCAGCAGG
GACAGCCAGACCAGCTGGATAAGAAACACGACACGGTCCAATCGCATTCAGAGCTAGACGTCCAGATGCGAGACGAGGGC
GAGGAGTCGAGCCAAGGCGACGAAACTGACGAGGGCCTTGCCGACAGCGATGATGGCAAAGCTGTCTGCAACAGCACTTC
TCACAATGACGGACGTGGTAACAGTCCGCCTGCCCCTGTTCCACATCCGACGACTTTGACCGCGACCTATTTTGTAGTCG
ACAGTTTCAACATTCACCGCCTCATAATTGCCGGTGTTACTTGTGCGAGCAAGTTCTTTTCGGATGTCTTTTACACGAAT
TCGCGATATGCAAAGGTACGCCGCAGACCCTAAATAACCGCCCGTCACTTTCTAGCTATCAGGGGGCCATCTGACATAAG
ACTAGGTGGGAGGACTTCCGCTTGCCGAGCTGAACCATCTAGAGCTTCAGTTTTTGATTCTCAATGACTTCCGCCTTGCC
ATTCCGCTGGAGGACCTTGAAGCGTACGCCACGATGCTTGTCGAATTTTACGCCCGCGAAGTTATTGGCAAACGAGCGCG
TCCATCGGGGGCCTCGCAGACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62