GenePrediction:GLEAN_4247 Details

Name: GLEAN_4247
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1164361..1160879 (- strand)
Length: 3483
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1164361..1164212 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_179:1163804..1163721 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_179:1163598..1163435 (- strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_179:1163158..1162855 (- strand)
Length: 304
Type: CDS
Source: GLEAN
Position: GCSC_179:1162725..1161963 (- strand)
Length: 763
Type: CDS
Source: GLEAN
Position: GCSC_179:1161899..1161781 (- strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_179:1161706..1160879 (- strand)
Length: 828
>GLEAN_4247 class=GenePrediction position=GCSC_179:1164361..1160879 (- strand)
ATGGCATATACGCATCGGGACGAAATTCCACCAGCCCTGAAAAACGGCGTGGATATTCAGCTGCAATCGGCATTTGCGGA
TGAGAACTGGCCAACGGTGATTCGCTTGGCCGACAAGAGGGCCAAGGCAAGCGGCGACGCCTACTATGAGGTTTGTTCCT
TAACAGCCACGGTACGATTCTGATCAGGAATATTGAGGATTGACACAGCAGCCTAGACTATCAAAATCTGTGCCGAGTCG
AAGCTAGATGGGGTATCAGAGAAATGTGCGGCTGCAGTGGCCGTAGATCTCTGGGTCAAAAAGGGTACAGTACCTGCGGA
TGTTGAATCTATTGACCTGCTTGAATGGGGATGTGCTGGGGCTCCTCCGCTGCAGGGCTACTCTGAAACCCTTGGCCTTC
TGCGATTGCGATGGGCCAAGGCAAACACTAAAGACACAAAAGGCCTTACATCTTGTTTGAGAGAATGCCTACTCAATTGG
GACCTCATAAATTCCCAGCAAGTGAATACGACTCTCACACGCCGACTTCTAAAGCACTCAGTAACCAATGTTTTTAGATT
GCTGCCATAATGGACAGGTCTTCCAACTCACATGACAGGCGCTTCATGTACTGGAATATTCTTTTAACCCACATGCTTTC
GGTCTGTGTGTTTCCGCTTACATCTACTCCAAAAACAGCACATGTGTATCCTAACAGGCCTAGACGAGTTCACATTGCCC
TGATGGAAAGCAGAAGATATATGGCATGCTTGCCCAAAAACAGCTTGAAAAGGCAGCAGAGCTCACTGCGGCGCACATAA
CAGGCCAGGAGCGAAGTCTTCAGTACGAGGAAGAGTTTCTGCTCTACTACAGGGTCGTCGCGAATCATGGATCGGTGGAA
GATTTTTTGAAGCTTTCACTGAATTCAGAAACCGGTGCTTTAAAGCAGTTTCGGCTTGGTCGCAAGCAGCCTTACATCGA
AGTGATATCAAAGCTTGAAGCTAGAGGCCAATGGAGTGCCGTATTTGACATTTGCCGACAAGGATTGCAGACAACGGCTA
CTTCAGGCGCACCCTCCACCATAGCTTGTGATTTGCAAATATGGAGAAGCTTCGTTATGGCTTCAAAAATGCAAGCAAAC
GTTGAGAAGTAAAGTTTTCCAGACGATTAGACGCCAGGGGGTAGAGAGGATATCAAACAAAGTTACTAACACTGCGATCA
CAGGGCATTTGACACGGTGCAGGAAGTTCTACAAAGCTTCATTTCGGCAAAATCCAAAATTCCACGCATGTTTACAAAAA
CCATCGGGATTGCACTGCTAGAGACAATCTTCGAACTGCCACCTTCACTTCTCGCAGAGAGCGATGAAGGCTTACCCTCT
CCCCGTGTAGAACAGCTTTTGGTTTATATTCAGGCGAATATAGAAAGAGCATCCGCTTTTGGAGATGTGAAAGGCTATGT
TGAAAGGCTTACGTTTGCAGAAAGCAAAGATTTGCTGCAAAAGCTGGCCGCTCTTTCTGTGGATGACGTAAGCCCACTCT
GGTCTTATCTTTGTTGACGCAGCTCTAACGGGATACAGGACAACGAAGCGGTATTCAAAATGCACCAGACAGTCCTGAAT
AATAAGCTACGGTACTTACTGGCCACATGTCCTCAGACACTGTGGCACAATACGGATGCATCAGGCACATCGACACCTTC
ATGCAAATATTGTGGCCAGCCAGCCGGGCTAGACGGATGCGCCAGCTGTTTCCACAACATCGCCCTCGACAGCCTAGAAG
CGCACAGTAAGATCTCGAAAGACGCCGATATCCTGGAGAGAATACAGAGAGTCGACAAGGACCCACGAGTCGATTTGATA
CTGGTTTCAGCAAGCTGCCTGATAAAGCTGGCAGGCATCCAGAATCACAAGGGTCACGGGAACATGGGCCAGCTGCACAT
CTCGTTTGCCAACGGGGCACGCTTCCTCCAGGCGACTGCTCTTCTGGAACGCCAATTAGAACAGACACCGGCCGAGATTT
CGCTGCAGCTTTTACTCGTACGCGTTTATTTGCTGTTAGGTTGGGCCTCACGTGCTCTTCAGCTTTGGAACCCGCTCGGC
GTCAAGCGCACCGTTCTGGACGCCCTTGGCCCGCTATTCTATGATCGATTGTCAACCGTTGCTCCAGCGTTGTTTCACGG
GAGCAAGCCATTGACTGAGGGCCTTCGTACATACTATGCCACCGTCCTACAGAAGCATTCGCCTGTCAAGATATGGGATG
CATTTACCTCGGGGAGTTACAGCAGCATCCTGGACATGGCCCAGTTCAACGACAATCTGCACCGCAGCTGTACGCGAGCA
ATGGCTGTACTTGAAGAGAGGCGCGCAGCCCGAGCGTTTGGGGGGAAACTAGAAGATGTCGAGAGCGTCTATATCTTCGG
TATGTAGCCTACGGTCCCTAGAACCCTAGGACCATCATACTAACCTCCACGGCGAATCGCAGCCGAAATCACCAATGATA
TAAACTTGGTCGATGCGACTGACTTTGGATCGATGCCGAATCTGAACTGTTCAGCCACCTCGAGTCTGGCCGAAGTGCTG
TCCATCGGTCCAGGCCTTGTGGTAAGCCCTTGCGAACTATTGCATTTAGTCTCCTTTAGGATGTGCGTTTTTGTCCCTGA
CTGTCCGCTTGCCAGAATACTCGGATGCACCTAGGCTTGCTCTCCGAGAAGCTCCTAGACCTGATGAGCCACAAGCCCCC
TAAGGAGTACAAGCCTTCAAAGCAAGCCGAGGCAGCACAACGAGAGCGAGCTTACCTCCTGGAGTCGTTGGCTGCTGTCG
AATCGTCATTCATGGAGTTTCTACACCATCCCGACACCCCAGGCAAGCTCACTGTCGCAGAACTGTCGCATTATACAATC
ATGGCACTGCTCTCCTCTCTAGCCGTAATCGGCGTCACCGCGATTCAGTCGACAGCTGTACCGTCGTATTTTGCAGATAT
CATGTCATCATTTACGACAATGTACGGCATAGCTCGTTCATCCGTTCAGGACACGCAGGGCTCAAGGGGTGTTGCTGCCG
AAGCTGTACTGCATGTATTCACAAATCTCCATGGGCTGTCGCTATTTCGTGACACGGCTATTGCTATCAAGCAAACATCG
ATGTTTCTCACAGCATTACATGACCGAGAAGCTGCACGCGACCGCAGCGGAAAGTCAGGATTTCACAAGGACGTCATAGC
AGCCACGCGGACGCTAAAAGTGACGTCCACACAGGCTTTCGCCGACTTCAAGGCAATCATCAAGCTCAGCAAGGACATAA
TGGCCGAGCCGGGGTTTCAGAGCGGCGTCAATGACTGGATAGCGAATTCTGATACCAGTAGCAAGACCGATAGTGCTGAT
GAGCTGTCACTTGCAGTCTTGTCGACGCTTGGTGAAAAATCTGACATGGGGGACTGGTCCGCTAAATTGGTAGGCGGCTG
GAGAGAGGCTCTGAAGGGCTGGGCCATGGTCCAGTTGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62