GenePrediction:GLEAN_4249 Details

Name: GLEAN_4249
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1154680..1152293 (- strand)
Length: 2388
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1154680..1154409 (- strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_179:1154338..1152796 (- strand)
Length: 1543
Type: CDS
Source: GLEAN
Position: GCSC_179:1152721..1152293 (- strand)
Length: 429
>GLEAN_4249 class=GenePrediction position=GCSC_179:1154680..1152293 (- strand)
ATGGCGCCTTCATTTGATCATCTGCGCGAGGCAGACCTCGACGAGGACGAGTTTGACGAGGATGATGTCGATATTTCGGA
TCTTCGCGCCAAGTACGAGGTGCAGCTAGAGGAAGGACTTGATACGTTTGTCGTCATCGATGGACTTCCGGTTGTAACTC
CGGAGCAGAAGCCCAAGCTTGTCAAGTTCCTGTTGAAAAAGCTGAACTCTGTTGGAAGAACTAAAGAAGACATGATTGAG
ATGCCGATAGGCCCAGACGGCAAATCACTACAGTATGCTCTTATGCCGTCATTGCCCAAATATGTCTCTGCAGTATTTTT
GAGGATTAACGCGTTTGGTCAGATTTGCCTTTGTTGAGTTTACGTCACCTGGCGAAGCTGCGGCCGCCGTCAGGCAACTT
GACAATGTTCCCCTCGACAAGAAGCACGTTTTGCGAGTTAACAAGCTGACCGACATCGAGCGATATGGAAGGGAGGGACG
AATCGACGAAGAGTACACAGCGCCAGTCATCGACGAGTTCCAGCCGAAGGACCATCTGCGCTCGTTCTTGGCAGACCCCA
GCGGTCGGGGCAGAGACCAATTTGTTATGTACCGTGGCGACAACGTCGGCGTCTGCTGGAACAGCGAAAAGGAAGCACCG
GAAAGCGTTGTCGACCGACCAAATTGGACGGAAAGCTTCGTTCAATGGTCTCCTCTTGGAACGTACCTGACATCCGTTCA
CATTCAGGGCGTTCAGCTCTGGGGTGGGCCAAAGTGGGACCGATTGGGCAGATTTCCCCACCCTTTCGTTAACCTCGTGG
CGTTCTCACCCACGGAAAACTATATTGTCACCTGGTCTGGTCGCCCGATCTCGATCCCTGACGAAGGTCATCCAGCGCTG
AGCTTAGACGACGATGGCAAAAACTACGTTATCTGGGATGTTGCAACCGCAAAACCTCTACGGTCATTTGCGAACAATGA
CGTCCACAAGGGTGACGATGAGGGTGCTGGGAAGCAGCAACAGAAGTCCCCCTGGCCTGCTTTCAAGTGGTCTTCGGACG
ACAAGTACGTTGCCCGGCTGACACAGGGGTCTGCCATTTCTGTCTACGAGCTTCCCCGGATGAACCTTCTAGACAAGTCA
ACGATCAAAATTGAAGGCGTGATGGACTTTGATTGGGCACCAGCACTACCTCAGCGGGACGGTGTCAAGACGTATGAGCA
ACTGTTTTGCTACTGGACGCCCGAGATTGGAAGCAATCCGGCCAAGGTCGGCCTGATGAGCGTCCCGTCGAAGGAGATTG
TTCGCACGTTGAATTTGTTTAGCGTGTCAGATGCCAAACTTCACTGGCAGTCCGATGCTGCGTATCTTTGCGTCAAGGTG
GACCGGCACTCGAAATCGAAGAAGTCTCAGGCAACAACACTCGAAATATTCCGCGTCAAGGAGAAGGGTGTTCCTGTGGA
AGTCCTCGACACGATCAAGGATACGGTTATCAACTTTGCCTGGGAGCCCAAGGGTGACCGATTTGTGATAATCACAACAT
CAGAGCCGACCGGGCCCACTGCAGTTCCCCCAAAGACGTCTGTTTCCTTTTACGCACCAGAGAAGGCAAAGGGAAATGCA
GTTGGAAACTTCAAGCACCTCCGAACTCTTGAGAAGAAAAACAGCAATGCTATTTACTGGTCACCCAAGGGACGCTTTGT
TGTCATCGCTACGGTGCATAGTCAGCAAGCTTCGGAGCTTGAGTTCTTCGACCTGGACTTTGAAGGCGAGAAGCCCGAGG
CTGAAAAGGACTTGACGGCAAACCTTCAATTAATGAACGTCGCCGAGCACTACGGGGTTACAGATGTTGAATGGGACCCA
TCTGGAAGATTTGTCGCAACTTGGGCGTCTGCCTGGAAGCACAGCGTGAGTTCAGCATGCATTGTTTGGTATACGTTCTA
TTTTTTTAGCATATTTACTAACCAGATCAACATATGTAGATGGAGAACGGTTATCACCTGTACGATTTCAGGGGTGAATT
GTTGCGAGAGGAGCACCTCGAAAAATTCAAGCAGTGGCAATGGAGGCCTCGCCCTGCGACACTACTTTCAAAAGAGGAGC
AGAAGACGATCCGCAAGAACCTGCGTGATTATTCGCGTGTGTTTGATCAGGAAGACGCAGAGCGGATAGCTGGCGCTGAT
CAGGAGGTTATTGACCGCCGGCGTCGCCTTCTTGAAGAGTGGGTTTCCTGGCGCGCGTCTGTTGAGAAGGATCTTGACGA
GGAGCGTGATGCTCTGCATATTCCCAAGAACCTGGTGGAGGAGCTGCTCAGGGCGAAGACGGAGGAGATAGCCTCTGGAG
AGGAAGAGAAGGTCGTTGAGGAGATAGTCGAAGAGGTTCTAGAGGAATCTGAAGAAATAGTTCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62