GenePrediction:GLEAN_4251 Details

Name: GLEAN_4251
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1133234..1131561 (- strand)
Length: 1674
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1133234..1133016 (- strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_179:1132953..1131997 (- strand)
Length: 957
Type: CDS
Source: GLEAN
Position: GCSC_179:1131935..1131561 (- strand)
Length: 375
>GLEAN_4251 class=GenePrediction position=GCSC_179:1133234..1131561 (- strand)
ATGTCTCACGAACTTGTGGCTGCCGGCCTCCTGCTGGCCGTCTATGTCCTTGCCCACTTCTTCAACAGGACGGAGACGCC
TAAGATCAAGAACCTGCCTGAGATTCCCGGAATCCCCATCTTTGGCAACCTAATCCAACTCGGCACAGACCATGCTCGCG
TCGCTAAGGCTTGGGCAGTTAGGTACGGGCCGGTTTTTCAGACCCGTCTGGGCAACCGGGTAAGCACCCTTTGAAAGATG
CATCTTGTGTGTGCATTAGCATCTCTGACATGGCTATGCAGCGGATTGTCTACGTCAACACGTACGAGACAGTCAAGTAC
TTTTGGATCAAGCACCAGCCCGCGCTAATTTCGCGTCCCACCTTCCATACCTTCCACTCCGTCGTCTCCTCCTCACAGGG
CTTCACCATAGGCACCTCACCCTGGGACAAATCTTGCAAGGCCCGACGCAAAGCTGCCGGCACCGCTCTCAACCGACCAG
CTGTACAGTCCTACATGCCCATCATCGACCTTGAGTCAACTGTGAGCATAAAGGAGCTGCTCACGGACTGCAACAACGGC
AGCCGCGAGGTCGATCCCAGCCCTTACTTCGCCCGATTTGCCCTCAACACGTCTTTGACACTCAACTACGGGTTTCGCAT
CGACGGCACCGTTGAAAGCGAGCTGCTACGCGAAATCACCCATGTCGAGCGCGAGATCTCCAATTTCCGATCCACCAGCA
ATAACTGGCAGGACTACGTGCCGCTTCTGCGCATTGCCAACCGCCAAAACTCTTCAGCCGAGGATTACCGTCTGCGCCGC
GACCGCTACCTGGCCCTCCTGCTCGATGGCCTCAAGCAGCGCATCGCTAGCAGCACTGACAAGCCCTGCATCACCGGTAC
CATCCTGAAAAACCCAGAGGCAAAACTCAACGAAGCCGAAATCAAGTCAATTTGCTTAACTATGGTCTCTGCCGGCCTCG
ACACCGTGCCAGGCAATTTGATAATGGGACTGGCATACATCTCTACCGAGCATGGACAGGAAATACAGAAGGCAGCACTC
CGGGCGATTGAGGAGGTCTACCCAAATGGCGACTGCTGGGAAAAGTGTCTTGTCGAGGAGAAGGTGCCCTATGTCACTGC
TTTTGTGAAGGAAACACTGCGCTTCTGGACCGTTATCCCGATATGTTTGCCACGCACCAGTGTCAAGGACATCCCGTACG
AAACCGCTGTCATTCCAGCTGGCACAACTTTTTACATGGTCAGATTCATAGCCCCATGGGTGGTATTTCTCCGACTAATA
ACAAAAATTATGTTTGCAGAATGCCTATGCCGCTAATTATGATGAGACTCGCTTCAAAGAGCCCAAGAGATTTATTCCGG
AGCGCTTCCTAGACGACAACGAGTCAGGCACGCCACACTACGCCTACGGCGCCGGCTCGCGCATGTGCGCCGGCTCCCAC
CTGGCTAACCGCGAGCTGTACACGGCCTTCATCCGGTTGATTACGGCATTCGAGATCCTGCCGAGCGGTGACCCAGCCGA
TGCACCCAAAATCGATCCCATCGAGTGCAGCATTAATCCGACCTCGCTGACGACTGACCCTCGGCCTTTCAAGATCCGCT
TCAAGCCAAGAAACAAGGCTCAACTGGACGAGTGGATTGCTGCGGCAGAGGCTAGAACACGCGAGCTGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62