GenePrediction:GLEAN_4252 Details

Name: GLEAN_4252
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1124110..1122521 (- strand)
Length: 1590
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1124110..1124023 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_179:1123929..1123825 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_179:1123728..1122521 (- strand)
Length: 1208
>GLEAN_4252 class=GenePrediction position=GCSC_179:1124110..1122521 (- strand)
ATGCGGCTATCAACAACGGCAGTATTATGTCTTGGCTGGACACTCATAGACTCGGCAGCCGCCGTTGATGTAGATTGGAC
ATCGTCCAGTACGTGGCTACCTCACCCTGCATCCTCATCCCCTCCCTCCCCCCCTCTATGCTTGAAAGACCGAGGACTTC
AATCTGACAGACAGTGTACAGGCTCCATTAAAGATGCAGCGGCTACGCTTGCCTACGGGCTGATGAAATACTATCACGGC
AACAATACCGGCGACACGCCAGGTAACCTGCCAGATCCCTATTACTGTAAGCCACCACCGCGCCGAACCATGGTTGGCCC
CGGGTAATTCAGCCATAACTTCCCTTCCTGTCTCGTGTCAACGCTCATTCTGTGATGTCTAGGGTGGGAGGCTGGCGCGA
TGTTCGACACTATGATTGAATACTGGGCCTACACCGGCGACGAGAGCTACGTCGATGTGACGTACCAGGCCATGCAGCAC
CAGGCTGGTGACAACGACGACTATATGCCGTCTAACCAGACCATGAACGAGGGAAACGACGACCAGGGATTCTGGGCGAT
GGCTGCGATGGTAGCTGCAGAGCGCAATTTTAAAAATCCCGGAAGCGACGGCGTGCAGTGGCTCAAACTCGCCCAGGCCG
TCTTTAACGAGTACGCCGGTCGATGGGATGCGGACAACTGTGGCGGCGGGCTGCGATGGCAGATCTACACATTTAACAAC
GGCTACACGTACAAAAACAGCATCGCCAACGGCTGCTTCTTCAACCTCGGCGCACGACTAGCCAGATACACCGGCAACAC
CACCTATGCTGATTGGGCTACGAAAATCTATGACTGGATGGTCGACGTGAACTTTATCGACAGCTCCTACAACGTCTATG
ACGGCGCCGGCTACGCCAGCAACGCCAACTGTACCCAAATTGATAAGGTGCAGTTCTCGTACAACGCCGGCATCTGGATG
CACGGCGCCGCCGTCATGTACAACTACACAAACGGGTCGACGACCTGGGAGACCCGCGTGCGCGGCCTCGTCAACCGCAC
GAGCGTGTATTTCTTCAACAACAGCGTCATGTACGAACCCTCGTGCGAGCCCCAGAGCACCTGTGATACCGACGAGCTGT
CGTTCAAGACCTATCTGATGCGCTGGATGGCCGGCACCATTCAGGCCGCCAGCTTCACCTACGACATGATATATCCGCTT
ATGCTTGCCTCGGCAAAGAGTGCCGCCTTGCAGTGTGATGGAACCGCCACCGCTTCCGACGGGTTCAAGGGCATCAGCGG
CACCGCGTGCGGGTCGCACTGGGTCGATGGGGCCACGTGGGATGGCACAAACGGCGTAGGCCAGCAGATGGCTGGCCTCG
CTGCCATCTTTTACAGCCAAGTCAATGCGTTCAACGTGTCGAGCCCTGTCACTACCAACACCGGAGGCACTTCGACCGGC
GATGCATCAGCCGGCACGGCAACAACCAACAAAACGGCGTTGACAACTCTCTCTGCGATCACTACGAGCGATAGGGTCGG
CGCAGGACTCTTGACGACGATCATTTTAGCGGCCATGCTCTGCGCTTGTTTTTTTATGATCCGAGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62