GenePrediction:GLEAN_4253 Details

Name: GLEAN_4253
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1110214..1108967 (- strand)
Length: 1248
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1110214..1110065 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_179:1109993..1109889 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_179:1109828..1109449 (- strand)
Length: 380
Type: CDS
Source: GLEAN
Position: GCSC_179:1109378..1108967 (- strand)
Length: 412
>GLEAN_4253 class=GenePrediction position=GCSC_179:1110214..1108967 (- strand)
ATGGGCCAAGTCGGGGGCCAGGGATACACATCCCTCATTGTTGCGTCCGTCATGCTCGGACTGAGCTGGCTGGTCGTCTC
TGCACGCCTCGCCGTGCGGCATTGGAAGAAGACAATTGGTGTGGACGACTATCTCATGCTCGCCGGGCTTGTATGTGCCG
TCCGTTAGCATTGTTCGGGTTTGCGTTTGAAATCGGCTCGACGCTAATGTCTTGAGCGCAGGCGCTATACTCTGTCACAG
CGAGTTTCGTGATCTCCGCGTGCTTTCACGGTTCTGGGCAGCATGCTTCAAAACTTACTACCGCGGACATAATGACGGGA
ACTAAGGTTTGTTTGGAGGCAGCGTACTATGCCGAGTGCCCATCGCGACTAACCAAGCCACCACAGCTCTTTTATATCGC
AGAGTACTTTTATGCAGGCTGTACGGCCCCCATTAAGTGGAGCATCTGCGTTTGCCTTATCCGAATCGCCGAATCCCGAC
GGGCTATTGTTTACGTCATCTGGGGCGTCATGGGGATGTCGGCATGTGCGACTCTGATCTTTATCATCACGATTGCCAAC
ATTTGCCATCCGATCCAGACGCTTTGGGGCGCCGCGCACGGCACTTGCAACGCCCGGCTCAACAGTGACGTGAGCTTCTT
CTTCTCGGCCGTGTCCATTGTCACGGACTGGACCCTTGCCACGCTCCCGGCCTTCCTGCTGTGGAATATCCAGATGAAGC
CGCGCGTCAAGCTCTCTTGCATGCTCATGCTCGGGCTCGGTGCTTTGTAAGTTAGCCTGTTGGTATACATGTGCTCGAGG
CTACTATAGCCGCAGAATTTGCTGACCAAATACCAGTGCAAGCACTGCCACCATTGTTCGTCTGCGCTACCTTACGCTGT
ACAACGACAGCGCGGAATTCATGTTCAGTACGGGCGCTATTGGCCTCTGGTCTGTCCTGGAAGAGGGCATCGGCATTATT
TCCGGGTCCATGCCGGCGCTCCGACCGCTCCTCAACCTGAGCATTTTTCATGGCAGCAGTTATAACATCAGCGACAATAG
GAACTTATCGACGAATGCCGTCGGTCTTCAGACTATTGGCGGTACCAACGGCAGAAAAGAAGCGCGCCGGCGCGCTAGTG
CCGATGATGACGGCGATAGCCAAAAGCAGATCTTCAAGCAGACGCAGATCAGCATATCGGGAGCAGACGGATCGCGGACG
GCTGACGAGGACTGGACTAAGCAACAGGTTCTGGGATGGCAGAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62