GenePrediction:GLEAN_4254 Details

Name: GLEAN_4254
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1103669..1102372 (- strand)
Length: 1298
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1103669..1103351 (- strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_179:1103279..1103265 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_179:1103185..1103136 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_179:1103062..1103043 (- strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_179:1102963..1102372 (- strand)
Length: 592
>GLEAN_4254 class=GenePrediction position=GCSC_179:1103669..1102372 (- strand)
ATGGCAATCGATTTGGCGTCATTCTATGGGAGCGGTGCCGCCACGCAGGGACGCAGACGAGGCCCAGGCCGGCCCCGAGG
CAGGGGAAAGGGCCGCGGCTGGGGCGACGTGATGCGCCCGGTCAGCAGAAGTCCTGCGGCCGCCCTGGCCACCCTAGCTT
CTGCTCAAGTGATCCGCGGACCGGCCCAGGCTGTCCACAAGAGGCGGTCGGCCGTCATGTCTCCTATGCGAGCGCGAACG
GTCATTTCGCTTAGGCGATCTTCTAGGCTAACAGGGATTCCCCCGATGCAGTCGGCTCCCGAACAGAAGTATCTCTCATG
TATGTATTCACCTCTCCATTCTCTCTGTGTGCTGTACACCATAGACGATGGCTGACTGTTGCTACTTTAGATTATGACGT
CACTCGTATGTTAATCGTGTTCTCCGTTCCATGTCGCAATGACGAAGTCGATGCCATAGCCCACATGTTAACCAAGTACT
ACAGTGACGTACGAAGACGTGCGCGCACTAAGGAATGACTGGCTCACGGACAACGTATGATTCTGCCACCACTGCTCTAC
CTCTCTCTGGAATGACCGTCATGCTGACATGTGCTCGCGTTGTCTAGAATATATCTTTTTGGGAAGAGTATGTCTGTCCG
AAGCCGTTGTTATCGAGTCACGCCGTGCTACGTCCATACCTCTGCTGACACGACGCTTTCTGGTAGATATCTCGAGCGCG
AAGTGCTACCCAAATATCCACAAGCCCGTATCGTCCTGCTGCGACCTTCTCTGAGCCTGTTACTTATGAACGAGAAGCCG
GAGGCGGCACGCAAGCAGCTTCCGGATCTTCGCAACATAACACACATTTTTCTGCCAATCACCGATGTCAAAGACCTCAG
CAAGCCAGAAGGCGGTACGCACTGGTCGCTGCTGCTGGTATCCACAATCGACGGCGTGGCCTTCCACTACGACTCGCTCG
GGTCCGTCAACATTAATGATGCACGATCGGCTACGATACGCCTTGCTGTTCTGTTGGGCATCGACTTCCGCTTCCGCAAC
ATTGAGGACACGCCACAACAGGAGAATGGTAACGACTGCGGCGTGTTTGTGTGCGTGCTGATGCGCTTTCTGCTCGTCAA
GCGGCTGCTCAATGCGCACGCGCGCGAGAAGGTGTCCATGGGCCTCGGCGGCAAGATGATTGATGCCAATGGTGGCCGCA
AGGAGATGCTCAAGATTATCGAGAGCCTGCGCCGCGAGGGTGAGCGCCGCCGCAGCACATCACCTTTCATGAAGAAGGAG
GTGCCACGCATCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62