GenePrediction:GLEAN_4255 Details

Name: GLEAN_4255
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1100814..1099210 (- strand)
Length: 1605
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1100814..1100556 (- strand)
Length: 259
Type: CDS
Source: GLEAN
Position: GCSC_179:1100489..1099210 (- strand)
Length: 1280
>GLEAN_4255 class=GenePrediction position=GCSC_179:1100814..1099210 (- strand)
ATGGCAGCCACAGACGCCAGCGACACTCGAGCGAAGCAACTCCGCCTGGAGATTGCTCGCGCCGAGACTGAGCTGCAAGG
TCTACGGGACCAGCTAGCACTGGCCGAATCAGACGAGGCAGATGAAAAACGTCGACTTCTGAACGAGAAAGGAGTGCTTG
ACAGCGATGCTGCCACGGCGCCCTGGCGCTGGCCGCTCAAGGAAGAAGAGTACGATCGCTATGCGCGGCAGTTGATCGTG
CCGGGCATCGGCATGCAAGGTGCGAGAAGACTGGCTGCCTATGTCATGTGACTTCATAATACTGCATGGCTGACAGACCC
TGCAGGCCAACTGCGTCTCCGTGCGGCATCTGTGCTCGTCGTGGGCGCCGGGGGCCTCGGCTGCCCCGCGGCCACGTATC
TGGCTGGTGCAGGCATCGGCCACATTGGCATTGTCGACTGCGACGTTGTCGAAACGTCCAACCTTCACCGGCAGATTGGC
CACACCACCGACCGAGTCGGCGTGCCCAAGGCCGTCAGCCTTGCTACGTCGTTGCGCCGCCTCAACCCGCTACCCCGCTA
CAGCAGCCATGTGGAGGCACTGACGCCGGCCAACGCAGCCGCCCTCGTCGCCGCCTACGATGTCGTGCTCGACTGCACCG
ACAATCCGGCCTCTCGCTACCTCGTCTCCGACGCCTGCGTGCGGGCCAGCCGGCCGCTCGTGTCCGCCGCCGCCCTGCGC
ACCGACGGCCAGCTCGCTGTGCTCAACTGGCCTGTCGGTGTCGGACCCTGCTACCGCTGCATCTTTCCACGGCCGTCACC
ACCGGCTAGCCGACTTTCGTGCGCCGAGGGCGGCGTGCTGGGACCCGTCGTCGGTGTGATTGGCGTCTTACAGGCTTTAG
AGGCCCTGCGCGTCATTATGGCCGAGCCGGACTGCATCGCTGCCCAGGCCGATAAACCGTCGCCCTCGCTGCTCCTCTTC
TCGGCGAAAGATGGCCATGGACGACTCGGCGCACCCAGCTTCCGCACCGTGCGTGTGGGCGGGCGCCGGCCAACCTGCTT
CGCCTGCTCGCCTACCGCACCGCTGCGCGCGATGGAGTCTCTGGAAAGCGTCGGAAGCAGCGGCATCAACGGCGAGTGGC
CTGACTACGTACAATTTTGTGGTGACGACACTATTGATGTGGGCGTGCAGCTGGCACCAGAGGAGCGCATTTCAGTACAG
GAGTTCCAAGACATTGTGACGAAGAAATCTGATATCTCCGCTGTTGTCGAGAATCCTCCATATTGGTTGCTAGATGTCCG
CGAAAAGGAGTTCTTCGACATGGGCAGTCTGGACGGTGCTCTCAACCTGCCCTTTTCTCGGATACAGTCAGCAATTCAGC
GCAGTAAGAGAAAGACAGATGCAGAGGAACAAGAGAGCAGTCCTTGGCCAGAGTGGCTGCCGGAGGGACTGGGACGACAT
TCGGCGCCAGTGTACGTTTTGTGTCGGGTTGGCATCAACTCGCAGATGGTAGCTAGCCAGCTAAAGGAGATGGGGCTTGC
TACGGACGGCCGCTTCATCGGTGACATCAAGGGCGGCATCCAGGCATGGAAGAGAAATATAGACAGTACGATACCATTTA
CATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62