GenePrediction:GLEAN_4258 Details

Name: GLEAN_4258
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1081448..1079185 (- strand)
Length: 2264
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1081448..1079760 (- strand)
Length: 1689
Type: CDS
Source: GLEAN
Position: GCSC_179:1079664..1079185 (- strand)
Length: 480
>GLEAN_4258 class=GenePrediction position=GCSC_179:1081448..1079185 (- strand)
ATGACGATAAAAGCAGGGCTCGCCCGCTGGAAGAGCGTGTCCTGGCGATCTGGCAAGGCGACGCTGCAGCACACAACCAA
GGCCCAATTCGCACTTCCCAGCCAAGTGTTTCTATCCGGCATCGCGATGCACTTGTCGACTCTCCTGCAGGTGGTGGCAG
TGCTGGCCGACGGGGCGTTGGCCCGGCCATGGGCGCCGCCGCCGAGCTACCGGATGCACGAGCGGCGTGAGATGGCGCAC
CCACGGTTGAAGCGACGGATGGAGGCGGACACGGTGCTGCCGATGCGCATCGGACTGCGTCAGAACGCGCAGTCGCTGGC
ACAGGCCGAGGCCTGGCTGATGGATGTGTCGCATCCGACGTCGGCTAACTTTGGAAAGCACTGGAGCGCGGAGGCCGTGA
TCGAGGCGTTCCAGCCATCCGGCGAGACGGTCGAGGTGGTGACGGCCTGGCTGGTGGGTGCGGGCATCTCCAAGGAGCGG
ATCACGCACAGCGACAACAAGGCGTGGCTGGCCTTTGACGCCACTGTGGCCGAGGCCGAGCAGCTGCTGCACACGGAGTA
TTTGCACGACGGGGCCGCAGGTCAGGCGCTGGTCGGCGTGGAGCAGTACCACCTGCCGGGCCACATACAGGAGCACGTCG
ACTACGTGACGCCGGGTGTGAAGGCCGTGGTGATGGATCTGGAGCGGCGGCAGAAGCGGTCGACGACGAGCAAGAAGATG
AAGGCGAAGCGGGTCACGCAGACTCTGGCACGCAACGCCCGGCGCAAGCTGCGGCCATTTCCCCGAAACGTCGGCGACGT
GACCGCCGCCAACTTGACGGCCTGCGACACGGTGCTGACGCCAGCCTGCATCCAGGCGCTGTACAACTTCACGGCGCCGG
AGGTCGACGCGACCGTCAGCACGGACAACGCTCTCGGCATCTTCGAGGAGGGCGACCACTACGACCAGGCCGACCTTAAC
TCGTTCTACGCTATGTACGCGCTCCAGGTTCCCAACGGCACGCACCCGGACCTGGACTCGATCGACGGCGGGGTGTCCCC
GATCGACGGTGATGCCGGTGGCGAGAGTCTGCTGGACTTTACGATCGCGTACCCTATTATCTACCCGCAGAACATTACGC
TCTACCAGACCGACGACGATTACTATGCTAACAACGGCAACGGAAGCTCGACCGGTCTCTTCAACACCTTTCTCGACGCA
ATCGACGGGTCTTACTGCACGTACGAAGCCTATGGCGAGAAGGGTGATTCGTCTATCGACCCGGTCTACCCTGACACCGA
GGCCCCGTCTGACTCTAACCCTTACGCCGGCAAGCTGATGTGCGGCGTCTACAAGCCGACCAACGTGATCAGCATCTCGT
ACGGTGTGTACGAGCAGGACCAGCCGTACGCGTACCAGGAGCGCCAGTGCAACGAGTACCTTAAGCTGGCGCTGCAGGGC
ACCACCATCCTCTTTGCCAGCGGCGACACTGGTGTCGGTGGCTATAACTACGGCACGCACGGCGAAGGGTTGTATTACGG
TTGTCTGGGCGATAACGATACCGTCTTTACGCCCTCGCAGGCCTGCAGCTGCCCGTGGGTTACCAACGTCGGCGCTACTG
AGGTCTTCCCGGGAAAGACCGTTTTCGAGCCGGAGGAAGCCGTGCTAGTGCAGGAGGACCGGATAAACGGGAACTACAGC
AGCAGCGGAGTAAGTTTTTGTCCTTTTGTCCTTTTGTCTTTGTTTTTATAATTTATGTTTTTCTTTCTTTCTTTCCCCCT
CTCTTCTCTCGCTAACATCTCTAGGGCTTCTCCAACATCTTCGGCATCCCTTCCTACCAGGCCGCAGCCATCGAGACCTA
CTTCAACGTCAGCAACCCGCCCTACCCCTACTACTACGACGGCAACTGGCAGAACGCCACCAACGGCGGCGTCTACAACC
GCAACGGTCGCGGCATTCCTGACGTCGCCGCCAACGGCTGGAACTACCCAGTCCCGCAGGACGGCGTGTTCTACCTGAGC
GGCGGCACCTCCCAGTCGGCCCCGCTGTTCGCCTCTCTGCTCAACCGCATCATCGATGAGCGCATCAAGATCGGCAAGGG
TGGCCTCGGCTTCATCAACCCTACCCTGTACGAGAACCCGGGCGTGCTCAACGACATCACCAAGGGCGACAACCCTGGCT
GCGGCACCCTCGGCTTCTCTGCCTCGGTCGGCTGGGACCCGGTCACCGGACTGGGCACGCCCAACTACCCCAAGATGCTG
GAGCTCTTCCTCTCGCTCCCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62