GenePrediction:GLEAN_4259 Details

Name: GLEAN_4259
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1073599..1072080 (- strand)
Length: 1520
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1073599..1073480 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_179:1073429..1072574 (- strand)
Length: 856
Type: CDS
Source: GLEAN
Position: GCSC_179:1072303..1072080 (- strand)
Length: 224
>GLEAN_4259 class=GenePrediction position=GCSC_179:1073599..1072080 (- strand)
ATGGCTCTTAGTCTCAGCGTCAGTGGTTTCGAAACAGAGGGGTTCCAACTTCTCTGTGATTTCGTGAACCATGAGAACTT
CCCTGACATCCCTGTGGAAGCTATGGAGCGGCTCAATCGGGTATGAGACTTCAAACAAATTATCAGAACCATCTCTGACG
GAGTACTTAGATCCTTATTCAAGTCCAGGGAGGTCAGATTTCGCGGCCTCGTGTCATGTTCAAGCTCTTTGACAAGCTGG
CCGAACGTGAACCAACGGAGGATGAAGTACGGGAGGTGTATGTCATGGCCTGGGTAGTAGAGCTGCTTCAGTTTGCTATT
CTCGCATCCGATGACATAGTCGACGGAGACCTCTGGCGGAGAGGGAGGTGGTCATGGCATCGACAACCAGGTGTCGGGTT
AAGTGCAGTCTATGATACATTCGTTGCAACATTCCTCGCCCTTGCCTTTCTGAAGAAACACTTGGACCAGAAGAAAGCTT
ACATTGGAATGGTCGAGTCCATCAATCGCGAGATTCTCTACGTCCAACTTTATCAGAGTTTCGATACCATGGTGGCCAAC
CAGGGGCCAGGAAACGTCTCAACATTCTGCGAGCACAAACTCCGCGACATATCGCTCGGCTTGTGTGGCTATTTCTTTCT
GCCCTTCTCATTGATGCTGCACTACCTCGGCCAAGGTACTCCCGATAACCTTAGGCAAACGCGGGAAATCACAGACGAGA
TATCTATCTATTACCAGGCCCAGAACGACTATATAGACTTGTATGGAGACAGAAGCAACAATGGAAAGGATGGGCGGGAT
ATCCGAGAGAACAAGTGTTCGTGGCTCATTGTGGAAGCTCTAAACAGAAGCGACAAAGGCCAGCGTACAGCACTGAAAAA
CAAATACGGTCGGTCGGATAAGGAATGCGTGGATGAGGTAAAGCAAATATTCAACGACCTGGATCTGAAGGGAGCCTTCA
AGCAGTATCAGTCCGGGGCAATCCAAAAGATAAAGGAACAAATCCAGTCTGTGGATGAGGGCAGCGGTATGAACCGAGAG
GTCTTGACATATTTCCTGGAAATAGTCATTGTTGTCTGAGGGAACAATTGTTATAGCTGGCTCTAAGAATGCATCATATT
TTCTGCGGGCCTCTGACGCCTTTAGTGCCATTTCTTTATACTTCAATCTCGCCGTGCAGATGAAATATCGATCGCCCGAT
ATAAGGCCTATGTTGTAGTGAACCATTATCCATATAATAGCAGCATTTTTAGATAGAGTATCGTTTATTAAAGAGAATTA
GAACTGTATTATGCAGGACATCCCTACGTTGGAACGAGACCTGGATCTATAAACGTCATCGTGTCCGACAAGCAGGACCA
CCTGCAGTACCTCACCATAGAAGATGCCATCCAGCACTGCACTAAGGGCGCCGGCATCTGGCCGCAGTTCAGCACCGACG
CCGGCCATGAGCCCGGCGTCCAGCTGGGCAGTGAATGCATAGTGTCCAAAAAATTCGTCCAGCCCATGTATTTTCTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62