GenePrediction:GLEAN_4261 Details

Name: GLEAN_4261
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1064861..1063321 (- strand)
Length: 1541
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1064861..1064651 (- strand)
Length: 211
Type: CDS
Source: GLEAN
Position: GCSC_179:1064132..1063689 (- strand)
Length: 444
Type: CDS
Source: GLEAN
Position: GCSC_179:1063616..1063321 (- strand)
Length: 296
>GLEAN_4261 class=GenePrediction position=GCSC_179:1064861..1063321 (- strand)
ATGGCAAAATTCCAAATCTCAGTTCCTTCATGCGTCAAAGAAGCCTTCGAGAGGCCGGTATCCAAGTTGGTGGTGAAGAA
GATTGATCACACGGGTCAGCACTTTTCGGAACAGTGGATGAATGGATGTCGTTACTATGTCTTCGATATCGTGCCGGACT
CCTTCAAACAGGCCGGGTTACCTGTTATCGCGCTTCTGACTCCGTCCGGGAGTAAGTCCTACTTGGTGGATGTCACATAC
TACCCAGATGAAGAAAAATAATATGGAGCAGTTTGGTAGGTCGGATATATTGCTCTGAATTGATTATGGTAGCTGTTATT
GTGGTATACGGCTTTCGTTGTTTAGTTAGCAAAAGAAACAACTAAAATAAAACTCGTTTCCTTGCACTGAATTTTCTTCC
CCTACATCATAATAAAGTGTCTGTGAACTGGTCCCTGCTATACGAACAAAAAAAACAAAAACAAAAGCACCAATACAAAG
GAGAACCGAGTTATAGACCCAATATCAAAATACCTCGTTTATTTCTAGCTTACTACGATGAATAAGCGGAATGCTGGCGG
ATAATTTAAGCCCCGACTCCGCCCCACCTATCAAAAATGCATCGCCGACCAAATCTGCAGACTTTCTCACTAGCGATCTT
TTGTGTACAGGCTTCAGGTTTGCAGTGACTCGAAGGCAGAAATAAAGACAAAAAATACAGTACTGTTTCTCAGTTGGAGC
TCTACAAAGCACGCACCTGGAAACTTGCCATGGCTGATCACGACACATGCCACATTCTGGTGATGGCCAGCGGAAACGGC
TCCAATTTCCAGGCCCTGGTCGACGGCATTGCGTCAGGGAAAATCAGCAATGCAAAAATTGAGCAGCTCGTGGTAAACCG
GGGCAAAGCATTTGCGACCCAACGAGCTGAAAAGGTGGGGATTCCTTGGGAATATTTCAATATGGTCAGCCACGGTTTTC
AGACCAAGGGCGAGTCAGACCCGATGAAGCTGCAGGCCAGCCGTGAGAAGTACGACGCAGCTCTCAGCCAGAAAATTCTT
CAGGGCTTTGGCGGAAAGGCTGCCCCGGACCTGATCGTGCTGGCTGGATGGATGCACGTGTTTACCAAGGCCTTCCTCGA
TCCATTGGAAGCAGCCGGCATCAAAATCATCAATCTACACCCTGCACTACCGGGTAAGCTAATTTTTGAAGTTTTTGTTC
TTCTCATTTTGCCCGTATGATATGATCTTACTTACGCCTGCAAAGGACAATATGATGGAGCCAATGCCATACAAAGGGCA
TTTGGCGATTTCCAGGCCGGAAAGTTAAAAAACGGCAAGACCGGAATCATGGTTCACTTCGTGATTGACGTAGTTGACCG
TGGAACTCCCATCATGACGGTGGAGATCCCGTGCCGGAAAGGCGAGGATATTCACCAGTTAGAGGAGAGAATACATGCCG
AGGAGCATGCGCTGATTGTGACTGCCACCCAGCAAGTGGCGCAGGAGGTTTTGCAATCCAAGAGAACGAGATTAGCTTCT
GCGGGTGTTGGGAGCGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62