GenePrediction:GLEAN_4262 Details

Name: GLEAN_4262
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1061345..1059407 (- strand)
Length: 1939
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1061345..1061199 (- strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_179:1061109..1060776 (- strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_179:1060695..1060441 (- strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_179:1060374..1059701 (- strand)
Length: 674
Type: CDS
Source: GLEAN
Position: GCSC_179:1059640..1059407 (- strand)
Length: 234
>GLEAN_4262 class=GenePrediction position=GCSC_179:1061345..1059407 (- strand)
ATGGACCTCTCACCGAAAAAGACGTCGAGTCTTGAAAAAGGCATTGCCTGCCAGCCTGTCGTGCAGGATCGGGATGTCGG
CCAGGGAGAGGTCATTGAGGTCGGAGACGGCGAGTACCGCAGAAACTTTTCTTACAGACAAATCCATGTATGTCCTTGGT
ATTTTGGGGGGTTTCTATTCTTCTCTTTAACATTCCCCCGTCCACCGTGTCGTGTCGTCTTTCTCACCACCGGCAGGTCA
TCTCCCTCGGCGGCCAAATCGGGGCTGGCCTCTTCATCTCGACCGGCAAAAACCTGAGTCATGGAGGTCCAGGTGGCCTC
TTGCTCGGCTTCCTCGTCGTCTGCTCCTGCGTCTGGGCACTGCACCAGACCCTCGGCGAGATGACCATTGGCTTCCCCGT
CTCGGGCAATTTTATTGATTTCGCCGACCGCTTTGTCGACCCCGCCTTTTCCTTTTCTGCCGGCTTCTCCATGTGGCTCG
GCTGGACGTCGGTCATTGCGGCCGAAGCTGTCTTCTTCACCACCATTGTCAACTACTGGGCTGAAGGTAGCGTACCGGAA
GCTGCCTGGCGTACGTCTGGTGAAGGCTCTATTTGTTCATTTTTTCTCGGCCAAGTCGTCGTTGAAGCTGACTTCATACT
ATCTTTTCAGTGACCATCTTCCTCGTCCTCTTGTTCGTTCTGTTCTGCCTGCCCAACACAGCCTTTGGCTGGTTCGAATA
CATTGCAGCCATTCTCAAGTTCGTGGCGCTTATCATCTTTCTCATCACGGGCCTCTGCCTCATTCTCGGCGCCGGCCCCA
GCGGACACAAAGCCGACGGTAAGGTTTGGACGACAGATCTGGCTTTTCGAAACGGATTCAAGGGTTTTGGACAAAGCACC
CTGCTGGCCATTCTCGCAATTGGAGGTAAGCTTTTGTTTCCATGGCGTACTAACAATAAACAAACAAAAGCGAATCTAAT
CACCCCTCCAGACAACACGTTTACCGGCTTCTTGGCTGGCGAGACAGGAAACCCACGATACTCCGTTGCACATGCTGCCT
TTCTGATCCCCATCCGCGTCACCGCATTCTACATCACGTCCGTCGTCTTCATCGGTTTGCTCATCTCGCCAACAAACAGC
CAGCTCTTCGGCAACAAGGGCGTTACAGCATCCCCGTTCGTCATTGCCATCAAGCAGGCCGGAATCACTGGTCTGCCAGA
CTTCCTCAATGCCATTATCGTCATTGCTGTGGCCTCCATTGCCGCGGAGAGCTTCTTCATTGCCTCTCGCATTCTTCGCT
CCATGGCCCATCAGCGTCTGATCCCTGGCATCTTGGCACGAGTCGATGCCAAGGGCCGTCCCATGCCGGCCTTGCTCTTG
ACCACTGCCATGACTATTTTGATGACCTACATCAACCTTAGCGCTGGGGGTACCGTCGTTTTTGACTGGCTCTCCCAGAT
TGCCAGCACCGGCTATTTCATGGTCTGGTTCTTTATTGCCGTCACGTCTTTTCGATTCCGAGCTGCCCTCAAAGCACAGA
ATGACCCGTTGCTCAGTGAGGCGTACGCCTGGAAGTGTGCGTTGTGGCCACTCCCTCCCATATGGCTGCTGATCTGCTGC
TGTTTGTTCATGGCCTGCTCTCTTTACCTGGCATTGTATCCGATCGTGAGTACTCTTTAGACGCTGTCGCCGTTTCACCC
TTGCTGACCAACCCCTCAAAATCAGGGCTCAAACACGGTGTCGGCGCACTACTTCTTCCAATATATGTTCGGCACAGTTC
TCATTCTTTTCTGTGGTATTGCATACAAGGCAATCCTTCGTACGAAGCTGCGAGATCCGAAGACTGCAGATCTGCAGACC
GGACGCCGGCCGTTGAGCACTGCTGAAATCGTTGACTTAGACGAGTACGAAAAGCTTTCACGATGGAGGAAGCTCTATTC
TTTCATCCAGGTGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62